Transcript: Mouse XM_006540320.2

PREDICTED: Mus musculus zinc finger protein 606 (Zfp606), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp606 (67370)
Length:
3701
CDS:
123..2390

Additional Resources:

NCBI RefSeq record:
XM_006540320.2
NBCI Gene record:
Zfp606 (67370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085248 CCCGAATGATAGAAGATAGAA pLKO.1 2971 3UTR 100% 5.625 7.875 N Zfp606 n/a
2 TRCN0000085252 CAAACTTCAAATTGGAGGAAA pLKO.1 1019 CDS 100% 4.950 3.960 N Zfp606 n/a
3 TRCN0000426559 GTCCACAAGGAATCCATATTT pLKO_005 2609 3UTR 100% 15.000 10.500 N Zfp606 n/a
4 TRCN0000432017 TAGTGGCGAGAAACGCTTTAT pLKO_005 2288 CDS 100% 13.200 9.240 N Zfp606 n/a
5 TRCN0000085250 CCAGTTAGAAATGTATCACAT pLKO.1 554 CDS 100% 4.950 3.465 N Zfp606 n/a
6 TRCN0000016104 GCAGATAAGGTTACCTGTGAA pLKO.1 777 CDS 100% 4.950 3.465 N ZNF606 n/a
7 TRCN0000085251 GCTCTTACCTTATTCAGCATA pLKO.1 1249 CDS 100% 4.950 3.465 N Zfp606 n/a
8 TRCN0000085249 GCCTTACTTCAACATCAGAAA pLKO.1 2346 CDS 100% 4.950 2.970 N Zfp606 n/a
9 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 2206 CDS 100% 13.200 6.600 Y Zfp808 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1283 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08999 pDONR223 100% 84.5% 85.2% None (many diffs) n/a
2 ccsbBroad304_08999 pLX_304 0% 84.5% 85.2% V5 (many diffs) n/a
Download CSV