Transcript: Mouse XM_006540382.2

PREDICTED: Mus musculus zinc finger protein 444 (Zfp444), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp444 (72667)
Length:
1507
CDS:
70..1065

Additional Resources:

NCBI RefSeq record:
XM_006540382.2
NBCI Gene record:
Zfp444 (72667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311153 CAGATGGGTCGTCAGCAATGA pLKO_005 398 CDS 100% 4.950 6.930 N Zfp444 n/a
2 TRCN0000095120 GCAAAGCCACTCCGGTGAGAA pLKO.1 684 CDS 100% 1.650 2.310 N Zfp444 n/a
3 TRCN0000316394 GCAAAGCCACTCCGGTGAGAA pLKO_005 684 CDS 100% 1.650 2.310 N Zfp444 n/a
4 TRCN0000095123 GTGCGGGAAGTCTCCCTTGAA pLKO.1 639 CDS 100% 1.650 2.310 N Zfp444 n/a
5 TRCN0000316463 GTGCGGGAAGTCTCCCTTGAA pLKO_005 639 CDS 100% 1.650 2.310 N Zfp444 n/a
6 TRCN0000095122 CCGCGGTAGCTCAAGGGACTT pLKO.1 992 CDS 100% 0.000 0.000 N Zfp444 n/a
7 TRCN0000095121 CGGCAAGGCATTCCGGCGTAA pLKO.1 726 CDS 100% 0.000 0.000 N Zfp444 n/a
8 TRCN0000316465 CGGCAAGGCATTCCGGCGTAA pLKO_005 726 CDS 100% 0.000 0.000 N Zfp444 n/a
9 TRCN0000304967 TGGTTCTCTCCATAGCCTAAA pLKO_005 1388 3UTR 100% 10.800 7.560 N Zfp444 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14197 pDONR223 98.8% 80% 84.4% None (many diffs) n/a
2 ccsbBroad304_14197 pLX_304 0% 80% 84.4% V5 (many diffs) n/a
3 TRCN0000467702 TCAATTATCACTAGGGGATGGATA pLX_317 21.8% 80% 84.4% V5 (many diffs) n/a
Download CSV