Transcript: Mouse XM_006540441.3

PREDICTED: Mus musculus calcium channel, voltage-dependent, gamma subunit 7 (Cacng7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacng7 (81904)
Length:
3143
CDS:
1043..1870

Additional Resources:

NCBI RefSeq record:
XM_006540441.3
NBCI Gene record:
Cacng7 (81904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434911 TATCGCTACGGGTGGTCCTTT pLKO_005 1559 CDS 100% 4.950 6.930 N Cacng7 n/a
2 TRCN0000069400 TGCGTTCGTTTCTGGCATCTT pLKO.1 1432 CDS 100% 4.950 6.930 N Cacng7 n/a
3 TRCN0000068354 CGGAGTCATGTCCGTGTACTT pLKO.1 1618 CDS 100% 4.950 3.960 N LOC385052 n/a
4 TRCN0000069399 GAGATCAACTTGGTGACGGAA pLKO.1 1286 CDS 100% 2.640 2.112 N Cacng7 n/a
5 TRCN0000416564 GCAGCTCTGAGCAGTACTTTC pLKO_005 1536 CDS 100% 10.800 7.560 N Cacng7 n/a
6 TRCN0000440192 ATCAACGACGAGGTCATGAAC pLKO_005 1508 CDS 100% 4.950 3.465 N Cacng7 n/a
7 TRCN0000069398 CGCCTTTGTCATCAGCAACAT pLKO.1 1381 CDS 100% 4.950 3.465 N Cacng7 n/a
8 TRCN0000069402 GCTTCTGAGTACTTTCTTGAA pLKO.1 1262 CDS 100% 4.950 3.465 N Cacng7 n/a
9 TRCN0000418522 GTGGGCTTGGTCCTATACATC pLKO_005 1481 CDS 100% 4.950 3.465 N Cacng7 n/a
10 TRCN0000044302 CATCAGCAACATCGGCCACAT pLKO.1 1390 CDS 100% 4.050 2.835 N CACNG7 n/a
11 TRCN0000068355 GCAGTACTTTCACTATCGCTA pLKO.1 1546 CDS 100% 2.640 1.848 N LOC385052 n/a
12 TRCN0000069401 CTCTGGAGAGTCTGCTTCTTT pLKO.1 1214 CDS 100% 5.625 3.375 N Cacng7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03873 pDONR223 100% 90.9% 100% None (many diffs) n/a
2 ccsbBroad304_03873 pLX_304 0% 90.9% 100% V5 (many diffs) n/a
3 TRCN0000469056 CCCTCCCTGTGCAAACTTCTAATG pLX_317 38.3% 90.9% 100% V5 (many diffs) n/a
Download CSV