Transcript: Mouse XM_006540542.2

PREDICTED: Mus musculus unc-45 myosin chaperone A (Unc45a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc45a (101869)
Length:
3728
CDS:
1001..3400

Additional Resources:

NCBI RefSeq record:
XM_006540542.2
NBCI Gene record:
Unc45a (101869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329187 GCACTGGGATGCTCGATACTT pLKO_005 3457 3UTR 100% 5.625 7.875 N Unc45a n/a
2 TRCN0000115159 CCGACTCTGTGAGAACTACAT pLKO.1 1741 CDS 100% 4.950 3.960 N Unc45a n/a
3 TRCN0000164749 CCACCTCAAGCTGGAAGATTA pLKO.1 623 5UTR 100% 13.200 9.240 N UNC45A n/a
4 TRCN0000292482 CCACCTCAAGCTGGAAGATTA pLKO_005 623 5UTR 100% 13.200 9.240 N UNC45A n/a
5 TRCN0000115157 GCAGAATCAGAGGCGTCTAAA pLKO.1 651 5UTR 100% 13.200 9.240 N Unc45a n/a
6 TRCN0000329114 TAGGCTCGGCATTGGTCAATT pLKO_005 2331 CDS 100% 13.200 9.240 N Unc45a n/a
7 TRCN0000329113 CAGAATCAGAGGCGTCTAAAG pLKO_005 652 5UTR 100% 10.800 7.560 N Unc45a n/a
8 TRCN0000329116 GTGTCAGCCATGACGTGTATG pLKO_005 2498 CDS 100% 10.800 7.560 N Unc45a n/a
9 TRCN0000329115 GTGTCATGGAGAGCGTGATAG pLKO_005 1875 CDS 100% 10.800 7.560 N Unc45a n/a
10 TRCN0000115156 CCACAGTTGCACTTTGGTGTT pLKO.1 3496 3UTR 100% 4.050 2.835 N Unc45a n/a
11 TRCN0000115158 GCTTCTCAGAACCTTGTGGTA pLKO.1 1085 CDS 100% 2.640 1.848 N Unc45a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08608 pDONR223 100% 75% 80% None (many diffs) n/a
2 ccsbBroad304_08608 pLX_304 0% 75% 80% V5 (many diffs) n/a
3 TRCN0000479523 ATTCAACGTGTGCAAATACCGGCG pLX_317 14% 75% 80% V5 (many diffs) n/a
Download CSV