Transcript: Mouse XM_006540571.3

PREDICTED: Mus musculus adaptor-related protein complex 3, beta 2 subunit (Ap3b2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap3b2 (11775)
Length:
3975
CDS:
418..3723

Additional Resources:

NCBI RefSeq record:
XM_006540571.3
NBCI Gene record:
Ap3b2 (11775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380857 CCACTACTGTGATGGGCATTA pLKO_005 3275 CDS 100% 10.800 15.120 N Ap3b2 n/a
2 TRCN0000306878 CGTTATGCGCGAACGCAATTC pLKO_005 1150 CDS 100% 10.800 15.120 N Ap3b2 n/a
3 TRCN0000294634 GACGATGTGCAACGAACATAG pLKO_005 1718 CDS 100% 10.800 15.120 N Ap3b2 n/a
4 TRCN0000294633 TACGTGTATCTGGTCCGATAT pLKO_005 697 CDS 100% 10.800 15.120 N Ap3b2 n/a
5 TRCN0000100719 CCAGAACGTATTGACCTGATT pLKO.1 1048 CDS 100% 4.950 6.930 N Ap3b2 n/a
6 TRCN0000100718 CCCTATGTAATGGACCCAGAT pLKO.1 1300 CDS 100% 4.050 5.670 N Ap3b2 n/a
7 TRCN0000306894 CAGAGTCAGTGGTGGTCATTA pLKO_005 1808 CDS 100% 13.200 9.240 N Ap3b2 n/a
8 TRCN0000380943 CGCTCGGAAGCCCTATGTAAT pLKO_005 1290 CDS 100% 13.200 9.240 N Ap3b2 n/a
9 TRCN0000382450 GAATGGACCAAATGTTCAAAT pLKO_005 2452 CDS 100% 13.200 9.240 N Ap3b2 n/a
10 TRCN0000100716 CCTGTATTTATGAGTGAGAAT pLKO.1 3394 CDS 100% 4.950 3.465 N Ap3b2 n/a
11 TRCN0000100717 CCTTCAAAGATCGTGACCATT pLKO.1 2261 CDS 100% 4.950 3.465 N Ap3b2 n/a
12 TRCN0000100715 GCACTGTTACCCACTGATCTT pLKO.1 3731 3UTR 100% 4.950 2.970 N Ap3b2 n/a
13 TRCN0000287130 GCACTGTTACCCACTGATCTT pLKO_005 3731 3UTR 100% 4.950 2.970 N Ap3b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13990 pDONR223 100% 87.4% 74.8% None (many diffs) n/a
2 ccsbBroad304_13990 pLX_304 0% 87.4% 74.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476411 GTACTTGAACTTTGCCACTTTCAG pLX_317 11.5% 87.4% 74.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV