Transcript: Mouse XM_006540709.3

PREDICTED: Mus musculus polymerase (DNA directed), gamma (Polg), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Polg (18975)
Length:
4190
CDS:
299..3139

Additional Resources:

NCBI RefSeq record:
XM_006540709.3
NBCI Gene record:
Polg (18975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305952 TCAACTATGGCCGCATCTATG pLKO_005 2265 CDS 100% 10.800 15.120 N Polg n/a
2 TRCN0000071239 CGGACCTTATAATGATGTGAA pLKO.1 1627 CDS 100% 4.950 6.930 N Polg n/a
3 TRCN0000071241 CCATGTCTGATACACCACGTA pLKO.1 2613 CDS 100% 2.640 3.696 N Polg n/a
4 TRCN0000325070 CCATGTCTGATACACCACGTA pLKO_005 2613 CDS 100% 2.640 3.696 N Polg n/a
5 TRCN0000305884 TTCTAAGGTGATGGGAATAAA pLKO_005 3495 3UTR 100% 15.000 10.500 N Polg n/a
6 TRCN0000071238 GCCTATAAGCTGGGTCTGAAT pLKO.1 2912 CDS 100% 4.950 3.465 N Polg n/a
7 TRCN0000071240 CGATACTATGAGCATGCACAT pLKO.1 310 CDS 100% 4.050 2.835 N Polg n/a
8 TRCN0000305951 GTTGTCCAGGGAGAGTTTATA pLKO_005 2678 CDS 100% 15.000 9.000 N Polg n/a
9 TRCN0000305950 TCTCAGGAGAGAGGTACAAAG pLKO_005 852 CDS 100% 10.800 6.480 N Polg n/a
10 TRCN0000052995 GCCATGAAGTGGCTGTTTGAA pLKO.1 2762 CDS 100% 5.625 3.938 N POLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.