Transcript: Mouse XM_006540715.3

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 5 (Ptpn5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn5 (19259)
Length:
3583
CDS:
928..2553

Additional Resources:

NCBI RefSeq record:
XM_006540715.3
NBCI Gene record:
Ptpn5 (19259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029905 GTGCGGAAGAATCGGTACAAA pLKO.1 1822 CDS 100% 5.625 7.875 N Ptpn5 n/a
2 TRCN0000029904 GCAGGCGGAATTCTTTGAAAT pLKO.1 1755 CDS 100% 0.000 0.000 N Ptpn5 n/a
3 TRCN0000029906 GATCCAGACATGCGAACAGTA pLKO.1 2469 CDS 100% 4.950 3.960 N Ptpn5 n/a
4 TRCN0000029907 CCTCTGAGTTCCTACATCAAT pLKO.1 1900 CDS 100% 5.625 3.938 N Ptpn5 n/a
5 TRCN0000029908 TCCTGCCTCATTGACTGTCAA pLKO.1 1539 CDS 100% 4.950 3.465 N Ptpn5 n/a
6 TRCN0000002664 GCTGCGACTCATCTCCCTCAA pLKO.1 2163 CDS 100% 1.350 0.945 N PTPN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09229 pDONR223 100% 84.8% 86.1% None (many diffs) n/a
2 ccsbBroad304_09229 pLX_304 0% 84.8% 86.1% V5 (many diffs) n/a
3 TRCN0000472997 GCTATGGCGAGTGCACGTAGATGT pLX_317 20.6% 84.8% 86.1% V5 (many diffs) n/a
Download CSV