Construct: ORF TRCN0000472997
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018274.1_s317c1
- Derived from:
- ccsbBroadEn_09229
- DNA Barcode:
- GCTATGGCGAGTGCACGTAGATGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PTPN5 (84867)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472997
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_006906.2 | 99.9% | 100% | 1563G>A |
| 2 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_032781.4 | 99.9% | 100% | 1563G>A |
| 3 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_011520411.3 | 96.3% | 92.5% | (many diffs) |
| 4 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_001278238.2 | 95.6% | 95.7% | 0_1ins72;1491G>A |
| 5 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_001039970.2 | 94.2% | 94.3% | 290_291ins96;1467G>A |
| 6 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_001278236.1 | 94.2% | 94.3% | 290_291ins96;1467G>A |
| 7 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | NM_001278239.2 | 90% | 90% | 0_1ins72;218_219ins96;1395G>A |
| 8 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018440.2 | 88% | 82.7% | 1327_1328ins161;1402G>A;1441_1487del |
| 9 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018441.2 | 82.3% | 79.2% | (many diffs) |
| 10 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018434.2 | 66.1% | 61.6% | 1327_1328ins161;1402G>A;1535_2157del |
| 11 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018435.2 | 66.1% | 61.6% | 1327_1328ins161;1402G>A;1535_2157del |
| 12 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018436.1 | 63% | 58.4% | (many diffs) |
| 13 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018437.1 | 61.9% | 57.4% | (many diffs) |
| 14 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018438.2 | 61% | 56.5% | (many diffs) |
| 15 | human | 84867 | PTPN5 | protein tyrosine phosphatas... | XM_017018439.1 | 58.8% | 54.2% | (many diffs) |
| 16 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | NM_001163565.1 | 84.8% | 86.1% | (many diffs) |
| 17 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | NM_013643.2 | 84.8% | 86.1% | (many diffs) |
| 18 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | XM_006540713.3 | 84.8% | 86.1% | (many diffs) |
| 19 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | XM_006540714.3 | 84.8% | 86.1% | (many diffs) |
| 20 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | XM_006540715.3 | 84.8% | 86.1% | (many diffs) |
| 21 | mouse | 19259 | Ptpn5 | protein tyrosine phosphatas... | XM_017322046.1 | 84.8% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1761
- ORF length:
- 1695
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ttatgaggga gccaggagtg agagagagaa ccacgctgct gatgactccg 121 agggaggggc cctggacatg tgctgcagtg agaggctacc gggtctcccc cagccgatag 181 tgatggaggc actggacgag gctgaagggc tccaggactc acagagagag atgccgccac 241 cccctcctcc ctcgccgccc tcagatccag ctcagaagcc accacctcga ggcgctggga 301 gccactccct cactgtcagg agcagcctgt gcctgttcgc tgcctcacag ttcctgcttg 361 cctgtggggt gctctggttc agcggttatg gccacatctg gtcacagaac gccacaaacc 421 tcgtctcctc tttgctgacg ctcctgaaac agctggaacc cacggcctgg cttgactctg 481 ggacgtgggg agtccccagt ctgctgctgg tctttctgtc cgtgggcctg gtcctcgtta 541 ccaccctggt gtggcacctc ctgaggacac ccccagagcc acccacccca ctgccccctg 601 aggacaggcg ccagtcagtg agccgccagc cctccttcac ctactcagag tggatggagg 661 agaagatcga ggatgacttc ctggacctcg acccggtgcc cgagactcct gtgtttgatt 721 gtgtgatgga catcaagcct gaggctgacc ccacctcact caccgtcaag tccatgggtc 781 tgcaggagag gaggggttcc aatgtctccc tgaccctgga catgtgcact ccgggctgca 841 acgaggaggg ctttggctat ctcatgtccc cacgtgagga gtccgcccgc gagtacctgc 901 tcagcgcctc ccgtgtcctc caagcagaag agcttcatga aaaggccctg gaccctttcc 961 tgctgcaggc ggaattcttt gaaatcccca tgaactttgt ggatccgaaa gagtacgaca 1021 tccctgggct ggtgcggaag aaccggtaca aaaccatact tcccaaccct cacagcagag 1081 tgtgtctgac ctcaccagac cctgacgacc ctctgagttc ctacatcaat gccaactaca 1141 tccggggcta tggtggggag gagaaggtgt acatcgccac tcagggaccc atcgtcagca 1201 cggtcgccga cttctggcgc atggtgtggc aggagcacac gcccatcatt gtcatgatca 1261 ccaacatcga ggagatgaac gagaaatgca ccgagtattg gccggaggag caggtggcgt 1321 acgacggtgt tgagatcact gtgcagaaag tcattcacac ggaggattac cggctgcgac 1381 tcatctccct caagagtggg actgaggagc gaggccTGAA GCATTACTGG TTCACATCCT 1441 GGCCCGACCA GAAGACCCCA GACCGGGCCC CCCCACTCCT GCACCTGGTG CGGGAGGTGG 1501 AGGAGGCAGC CCAGCAGGAG GGGCCCCACT GTGCCCCCAT CATCGTCCAC TGCAGTGCAG 1561 GGATTGGGAG GACCGGCTGC TTCATTGCCA CCAGCATCTG CTGCCAGCAG CTGCGGCAGG 1621 AGGGTGTAGT GGACATCCTG AAGACCACGT GCCAGCTCCG TCAGGACAGG GGCGGCATGA 1681 TCCAGACATG CGAGCAGTAC CAGTTTGTGC ACCACGTCAT GAGCCTCTAC GAAAAGCAGC 1741 TGTCCCACCA GTCCCCAGAA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1801 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1861 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCTA TGGCGAGTGC 1921 ACGTAGATGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt