Transcript: Mouse XM_006540795.3

PREDICTED: Mus musculus testis-specific serine kinase substrate (Tsks), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsks (22116)
Length:
1896
CDS:
79..1800

Additional Resources:

NCBI RefSeq record:
XM_006540795.3
NBCI Gene record:
Tsks (22116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362743 GCAGATGAGTTGTGCACTATG pLKO_005 1225 CDS 100% 10.800 15.120 N Tsks n/a
2 TRCN0000079088 GCCACTTTGGACTATATGCAT pLKO.1 1733 CDS 100% 3.000 4.200 N Tsks n/a
3 TRCN0000079092 AGCAGATGAGTTGTGCACTAT pLKO.1 1224 CDS 100% 4.950 3.960 N Tsks n/a
4 TRCN0000079089 CCTGCCAAAGGGATAACGAAA pLKO.1 202 CDS 100% 4.950 3.960 N Tsks n/a
5 TRCN0000079091 CAATCCAAAGAGATCCACGAA pLKO.1 109 CDS 100% 2.640 2.112 N Tsks n/a
6 TRCN0000362679 GGTGGCCACTTTGGACTATAT pLKO_005 1729 CDS 100% 13.200 9.240 N Tsks n/a
7 TRCN0000362742 GCTCTGTGCTGAGTGAGAATC pLKO_005 575 CDS 100% 10.800 7.560 N Tsks n/a
8 TRCN0000362676 TCAGTGGAAGACGCTGAAATC pLKO_005 703 CDS 100% 10.800 7.560 N Tsks n/a
9 TRCN0000037652 CAGAGGCTACACAAGAAGATT pLKO.1 1531 CDS 100% 5.625 3.375 N TSKS n/a
10 TRCN0000079090 GCTGGAGGAGAAGCTAAGATA pLKO.1 756 CDS 100% 5.625 3.375 N Tsks n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10464 pDONR223 100% 76.2% 69.1% None (many diffs) n/a
2 ccsbBroad304_10464 pLX_304 0% 76.2% 69.1% V5 (many diffs) n/a
3 TRCN0000476596 GACACATATGAGACCCCTAACGCC pLX_317 14.7% 76.2% 69.1% V5 (many diffs) n/a
Download CSV