Transcript: Mouse XM_006540806.3

PREDICTED: Mus musculus zinc finger and SCAN domain containing 2 (Zscan2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zscan2 (22691)
Length:
4674
CDS:
532..2376

Additional Resources:

NCBI RefSeq record:
XM_006540806.3
NBCI Gene record:
Zscan2 (22691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415282 AGGGTGCTCTTGTCCGATTTC pLKO_005 749 CDS 100% 10.800 8.640 N Zscan2 n/a
2 TRCN0000433054 AGCCGGAAATCCCACCTTATC pLKO_005 1225 CDS 100% 10.800 7.560 N Zscan2 n/a
3 TRCN0000084271 GCACCTGAAAGAGAAGCTTTA pLKO.1 2352 CDS 100% 10.800 7.560 N Zscan2 n/a
4 TRCN0000084270 CAGTTACAACTCCAACCTGAT pLKO.1 1644 CDS 100% 4.050 2.835 N Zscan2 n/a
5 TRCN0000084269 CCTTAATACTCACCAGGGCAT pLKO.1 1575 CDS 100% 2.160 1.512 N Zscan2 n/a
6 TRCN0000084272 ACATGGGATGTTCTTGAACAT pLKO.1 999 CDS 100% 0.495 0.347 N Zscan2 n/a
7 TRCN0000084268 CCTTTGGTTCAGGTACCTCAA pLKO.1 571 CDS 100% 0.000 0.000 N Zscan2 n/a
8 TRCN0000108182 CGGGAGAGAAACCATACAAAT pLKO.1 1685 CDS 100% 13.200 6.600 Y ZNF782 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4078 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 4082 3UTR 100% 15.000 7.500 Y KAAG1 n/a
11 TRCN0000015356 GAGAAACCATACAAATGCAAT pLKO.1 1690 CDS 100% 4.950 2.475 Y ZNF285 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.