Transcript: Mouse XM_006540815.3

PREDICTED: Mus musculus predicted gene 4884 (Gm4884), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4884 (233164)
Length:
2984
CDS:
161..2824

Additional Resources:

NCBI RefSeq record:
XM_006540815.3
NBCI Gene record:
Gm4884 (233164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191566 GCATCATCTAACACATCATTT pLKO.1 2504 CDS 100% 13.200 7.920 N Gm4884 n/a
2 TRCN0000192304 CCAGAGAACAAGTCCAAGAAA pLKO.1 1697 CDS 100% 5.625 3.375 N Gm4884 n/a
3 TRCN0000191663 GCAAAGATTGTCTATCTCCAT pLKO.1 2064 CDS 100% 2.640 1.584 N Gm4884 n/a
4 TRCN0000284202 CATGGGTAATGCCTATCTTAA pLKO_005 346 CDS 100% 13.200 6.600 Y Gm5592 n/a
5 TRCN0000270249 CATGGAAGAAAGTCGACATTC pLKO_005 2622 CDS 100% 10.800 5.400 Y Gm5592 n/a
6 TRCN0000270202 TGCCAGATCATTGCAACAAAG pLKO_005 2830 3UTR 100% 10.800 5.400 Y Gm5592 n/a
7 TRCN0000201154 CAGTCAAGGAACAGAGTCAAA pLKO.1 1733 CDS 100% 4.950 2.475 Y Gm4884 n/a
8 TRCN0000201169 GCAAGAACAGAAGAGCTAGAA pLKO.1 1650 CDS 100% 4.950 2.475 Y Gm4884 n/a
9 TRCN0000201155 CCTGATTCTGATAATGCCCAT pLKO.1 1262 CDS 100% 2.160 1.080 Y Gm4884 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540815.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.