Transcript: Mouse XM_006540911.3

PREDICTED: Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial (Idh2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Idh2 (269951)
Length:
2126
CDS:
565..1563

Additional Resources:

NCBI RefSeq record:
XM_006540911.3
NBCI Gene record:
Idh2 (269951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219071 ATCTTTGACAAGCACTATAAG pLKO_005 1369 CDS 100% 13.200 18.480 N IDH2 n/a
2 TRCN0000429789 ATCTTTGACAAGCACTATAAG pLKO_005 1369 CDS 100% 13.200 18.480 N Idh2 n/a
3 TRCN0000419776 CAACACCGACGAGTCCATTTC pLKO_005 1230 CDS 100% 10.800 15.120 N Idh2 n/a
4 TRCN0000437043 CAAGGAGTGGGAGGTGTATAA pLKO_005 1176 CDS 100% 13.200 9.240 N Idh2 n/a
5 TRCN0000041712 GAAGAGTTCAAGCTGAAGAAA pLKO.1 934 CDS 100% 5.625 3.938 N Idh2 n/a
6 TRCN0000041711 CGTGGATGTTCAGCTCAAGTA pLKO.1 786 CDS 100% 4.950 3.465 N Idh2 n/a
7 TRCN0000041709 GCTCTACTTGAGCACCAAGAA pLKO.1 1299 CDS 100% 4.950 3.465 N Idh2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00817 pDONR223 100% 64.4% 67.4% None (many diffs) n/a
2 ccsbBroad304_00817 pLX_304 0% 64.4% 67.4% V5 (many diffs) n/a
3 TRCN0000466032 CCCCTTCTCACCGTGAGCAATTGG pLX_317 22.9% 64.4% 67.4% V5 (many diffs) n/a
Download CSV