Transcript: Mouse XM_006541118.3

PREDICTED: Mus musculus AKT1 substrate 1 (proline-rich) (Akt1s1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akt1s1 (67605)
Length:
2053
CDS:
588..1370

Additional Resources:

NCBI RefSeq record:
XM_006541118.3
NBCI Gene record:
Akt1s1 (67605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198644 CGATCGTCAGATGAGGAGAAT pLKO.1 1200 CDS 100% 4.950 6.930 N Akt1s1 n/a
2 TRCN0000198713 CCTGACAATTGTATCCCGGTT pLKO.1 1765 3UTR 100% 2.160 1.728 N Akt1s1 n/a
3 TRCN0000197732 GAAGCTGAAGCGGAAATATTA pLKO.1 1349 CDS 100% 15.000 10.500 N Akt1s1 n/a
4 TRCN0000166394 CCAGAAGCTGAAGCGGAAATA pLKO.1 1346 CDS 100% 13.200 9.240 N AKT1S1 n/a
5 TRCN0000439318 AGCGACTTCCAGAAGCTGAAG pLKO_005 1338 CDS 100% 4.050 2.835 N AKT1S1 n/a
6 TRCN0000181472 CAATACCAGCGACTTCCAGAA pLKO.1 1331 CDS 100% 4.050 2.835 N Akt1s1 n/a
7 TRCN0000165800 CTTCAAGGAGAAGAGGACAGA pLKO.1 1175 CDS 100% 2.640 1.584 N AKT1S1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12815 pDONR223 100% 42.7% 46.1% None (many diffs) n/a
2 ccsbBroad304_12815 pLX_304 0% 42.7% 46.1% V5 (many diffs) n/a
3 TRCN0000479778 TTATACGTGCAAGCCCCTCCCCAA pLX_317 88.6% 42.7% 46.1% V5 (many diffs) n/a
Download CSV