Transcript: Mouse XM_006541546.2

PREDICTED: Mus musculus RAP2C, member of RAS oncogene family (Rap2c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rap2c (72065)
Length:
3706
CDS:
656..1207

Additional Resources:

NCBI RefSeq record:
XM_006541546.2
NBCI Gene record:
Rap2c (72065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048176 CATTGAAGATTTCTACCGCAA pLKO.1 760 CDS 100% 2.160 3.024 N RAP2C n/a
2 TRCN0000377097 CAACTTGTGTTGTCCAGTAAA pLKO_005 1188 CDS 100% 13.200 9.240 N Rap2c n/a
3 TRCN0000102802 CGGGACTTTCATTGAGAAATA pLKO.1 730 CDS 100% 13.200 9.240 N Rap2c n/a
4 TRCN0000366700 TCGTCAGGCAAATGAACTATT pLKO_005 1134 CDS 100% 13.200 9.240 N Rap2c n/a
5 TRCN0000377029 AGCCAATGAGAGATCAGATTG pLKO_005 936 CDS 100% 10.800 7.560 N Rap2c n/a
6 TRCN0000436764 CAGAGCTCTGGCTCAAGAATG pLKO_005 1048 CDS 100% 10.800 7.560 N RAP2C n/a
7 TRCN0000377030 GAACCAGAGAGAGAGGTTATG pLKO_005 1016 CDS 100% 10.800 7.560 N Rap2c n/a
8 TRCN0000366701 GAGTGAAGAGATACGAGAAAG pLKO_005 960 CDS 100% 10.800 7.560 N Rap2c n/a
9 TRCN0000102803 CTCATCCTAGTGGGAAACAAA pLKO.1 986 CDS 100% 5.625 3.938 N Rap2c n/a
10 TRCN0000048177 AGAAGCAAGATCAGTGTTGTA pLKO.1 1167 CDS 100% 4.950 3.465 N RAP2C n/a
11 TRCN0000102801 CAAGGTTTCATCCTGGTGTAT pLKO.1 881 CDS 100% 4.950 3.465 N Rap2c n/a
12 TRCN0000102804 GTTTGGTTAATCAACAGTCTT pLKO.1 903 CDS 100% 4.950 3.465 N Rap2c n/a
13 TRCN0000102800 CCTGTGAAATTCTAAAGGAAT pLKO.1 3097 3UTR 100% 4.950 2.970 N Rap2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08770 pDONR223 100% 94.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_08770 pLX_304 0% 94.7% 99.4% V5 (many diffs) n/a
3 TRCN0000466597 GGCAAACCACCGGTAATATGTCGA pLX_317 51.3% 94.7% 99.4% V5 (many diffs) n/a
Download CSV