Transcript: Human XM_006710278.4

PREDICTED: Homo sapiens PATJ crumbs cell polarity complex component (PATJ), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PATJ (10207)
Length:
4207
CDS:
115..4005

Additional Resources:

NCBI RefSeq record:
XM_006710278.4
NBCI Gene record:
PATJ (10207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160681 CGATCACGCATGAGCATATTT pLKO.1 3889 CDS 100% 15.000 21.000 N PATJ n/a
2 TRCN0000236325 CGATCACGCATGAGCATATTT pLKO_005 3889 CDS 100% 15.000 21.000 N PATJ n/a
3 TRCN0000162664 CTCGACTGTATCTGGGTTATT pLKO.1 417 CDS 100% 13.200 18.480 N PATJ n/a
4 TRCN0000159109 GTACATAACAAGGCCAACAAA pLKO.1 3619 CDS 100% 5.625 7.875 N PATJ n/a
5 TRCN0000161817 CGTACATAACAAGGCCAACAA pLKO.1 3618 CDS 100% 4.950 6.930 N PATJ n/a
6 TRCN0000160184 CCTGATTATGAAGTAATGGTT pLKO.1 1723 CDS 100% 3.000 2.400 N PATJ n/a
7 TRCN0000158824 GCAAGAAGATTTGCCTTTATA pLKO.1 3144 CDS 100% 15.000 10.500 N PATJ n/a
8 TRCN0000159811 GAAACTAATGTGGATGGTGAA pLKO.1 1576 CDS 100% 4.050 2.835 N PATJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11469 pDONR223 100% 90.4% 89.9% None (many diffs) n/a
2 ccsbBroad304_11469 pLX_304 0% 90.4% 89.9% V5 (many diffs) n/a
Download CSV