Transcript: Human XM_006710559.4

PREDICTED: Homo sapiens low density lipoprotein receptor adaptor protein 1 (LDLRAP1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDLRAP1 (26119)
Length:
4377
CDS:
71..907

Additional Resources:

NCBI RefSeq record:
XM_006710559.4
NBCI Gene record:
LDLRAP1 (26119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428736 TGACATGTGCAGTGCTGTAAT pLKO_005 2758 3UTR 100% 13.200 18.480 N LDLRAP1 n/a
2 TRCN0000063463 CGACAAGGTGTTTGCATACAT pLKO.1 445 CDS 100% 5.625 7.875 N LDLRAP1 n/a
3 TRCN0000063467 GCTTGCCCAGTCTCGGACAAA pLKO.1 2339 3UTR 100% 1.650 2.310 N LDLRAP1 n/a
4 TRCN0000063466 GATGCTGTTCAGCCTCAAGTA pLKO.1 205 CDS 100% 4.950 3.465 N LDLRAP1 n/a
5 TRCN0000063464 GTCCATATACAGGATCTCCTA pLKO.1 403 CDS 100% 2.640 1.848 N LDLRAP1 n/a
6 TRCN0000063465 GAGAAAGAGAAGAGGGACAAA pLKO.1 602 CDS 100% 4.950 2.970 N LDLRAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11812 pDONR223 100% 72.4% 70% None (many diffs) n/a
2 ccsbBroad304_11812 pLX_304 0% 72.4% 70% V5 (many diffs) n/a
3 TRCN0000472559 TTATTCTGCGCAGCTCAGATTGTC pLX_317 56.2% 72.4% 70% V5 (many diffs) n/a
Download CSV