Transcript: Human XM_006710663.3

PREDICTED: Homo sapiens nerve growth factor (NGF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NGF (4803)
Length:
943
CDS:
63..788

Additional Resources:

NCBI RefSeq record:
XM_006710663.3
NBCI Gene record:
NGF (4803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058405 TGGCGGTTTATCCGGATAGAT pLKO.1 720 CDS 100% 5.625 7.875 N NGF n/a
2 TRCN0000058407 CACGACTCACACCTTTGTCAA pLKO.1 668 CDS 100% 4.950 6.930 N NGF n/a
3 TRCN0000068128 GCATAGCGTAATGTCCATGTT pLKO.1 53 5UTR 100% 4.950 6.930 N Ngf n/a
4 TRCN0000438167 CAGACCCGCAACATTACTGTG pLKO_005 258 CDS 100% 4.050 5.670 N NGF n/a
5 TRCN0000058406 GCGGTCATCATCCCATCCCAT pLKO.1 422 CDS 100% 0.880 0.704 N NGF n/a
6 TRCN0000432713 TGTTGGGAGAGGTGAACATTA pLKO_005 538 CDS 100% 13.200 9.240 N NGF n/a
7 TRCN0000419305 AGCACTGGAACTCATATTGTA pLKO_005 646 CDS 100% 5.625 3.938 N NGF n/a
8 TRCN0000058403 CAACAGTGTATTCAAACAGTA pLKO.1 560 CDS 100% 4.950 3.465 N NGF n/a
9 TRCN0000442190 TAAGACCACCGCCACAGACAT pLKO_005 497 CDS 100% 4.950 3.465 N NGF n/a
10 TRCN0000068130 CACTGGACTAAACTTCAGCAT pLKO.1 168 CDS 100% 2.640 1.848 N Ngf n/a
11 TRCN0000437161 TGCAGACACTCAGGATCTGGA pLKO_005 353 CDS 100% 2.640 1.848 N NGF n/a
12 TRCN0000058404 ACTGGACTAAACTTCAGCATT pLKO.1 169 CDS 100% 4.950 2.970 N NGF n/a
13 TRCN0000437913 CCACACTCAGAGAGCAATGTC pLKO_005 120 CDS 100% 4.950 2.970 N NGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710663.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06640 pDONR223 100% 99.8% 99.5% None 104C>T n/a
2 ccsbBroad304_06640 pLX_304 0% 99.8% 99.5% V5 104C>T n/a
3 TRCN0000468216 AGCCTCCGCCTCAAGGCTGACCAC pLX_317 56.1% 99.8% 99.5% V5 104C>T n/a
Download CSV