Transcript: Human XM_006710701.4

PREDICTED: Homo sapiens spermatogenesis associated 6 (SPATA6), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA6 (54558)
Length:
1249
CDS:
197..1153

Additional Resources:

NCBI RefSeq record:
XM_006710701.4
NBCI Gene record:
SPATA6 (54558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710701.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248456 TCTGGACACCATGATTCAAAC pLKO_005 545 CDS 100% 10.800 7.560 N Spata6 n/a
2 TRCN0000061811 CCTCCATTTGTGATTAGACAT pLKO.1 956 CDS 100% 4.950 3.465 N SPATA6 n/a
3 TRCN0000061809 CGCATGTGTGAGCTATCTGAA pLKO.1 869 CDS 100% 4.950 3.465 N SPATA6 n/a
4 TRCN0000061810 CGACTTCAGTGATTACTGAAT pLKO.1 630 CDS 100% 0.495 0.347 N SPATA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710701.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12060 pDONR223 100% 65.4% 64.3% None (many diffs) n/a
2 ccsbBroad304_12060 pLX_304 0% 65.4% 64.3% V5 (many diffs) n/a
3 TRCN0000465803 ATGTTGCTTGATGAAGCCAGGCTC pLX_317 23.8% 65.4% 64.3% V5 (many diffs) n/a
Download CSV