Construct: ORF TRCN0000465803
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004896.1_s317c1
- Derived from:
- ccsbBroadEn_12060
- DNA Barcode:
- ATGTTGCTTGATGAAGCCAGGCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA6 (54558)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465803
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54558 | SPATA6 | spermatogenesis associated 6 | NM_001286238.2 | 99.8% | 99.5% | 74T>C;83A>T |
2 | human | 54558 | SPATA6 | spermatogenesis associated 6 | NM_019073.4 | 96.5% | 96.3% | 74T>C;83A>T;1147_1194del |
3 | human | 54558 | SPATA6 | spermatogenesis associated 6 | NM_001286239.1 | 93.7% | 93.2% | (many diffs) |
4 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001509.2 | 87.1% | 80.4% | (many diffs) |
5 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001511.2 | 85.8% | 81.9% | (many diffs) |
6 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_006710699.3 | 84.5% | 84.2% | (many diffs) |
7 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_011541606.2 | 83.1% | 82.8% | 74T>C;83A>T;908_909ins237 |
8 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001510.1 | 81.8% | 81.5% | (many diffs) |
9 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_011541608.1 | 74.5% | 74.5% | 0_1ins324;823_870del |
10 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_011541609.2 | 74.5% | 74.5% | 0_1ins324;823_870del |
11 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001512.1 | 74.5% | 74.5% | 0_1ins324;823_870del |
12 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001513.1 | 74.5% | 74.5% | 0_1ins324;823_870del |
13 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_011541607.2 | 72.8% | 68.4% | (many diffs) |
14 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001514.1 | 70.7% | 69.6% | (many diffs) |
15 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_006710700.2 | 69.9% | 69.2% | (many diffs) |
16 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_006710701.4 | 65.4% | 64.3% | (many diffs) |
17 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XM_017001515.1 | 63% | 59.5% | (many diffs) |
18 | human | 54558 | SPATA6 | spermatogenesis associated 6 | XR_001737243.2 | 28.5% | (many diffs) | |
19 | mouse | 67946 | Spata6 | spermatogenesis associated 6 | NM_026470.3 | 87.7% | 87.5% | (many diffs) |
20 | mouse | 67946 | Spata6 | spermatogenesis associated 6 | XM_006503346.3 | 73.8% | 73.1% | (many diffs) |
21 | mouse | 67946 | Spata6 | spermatogenesis associated 6 | XM_006503347.3 | 66.9% | 66.3% | (many diffs) |
22 | mouse | 67946 | Spata6 | spermatogenesis associated 6 | XM_006503348.3 | 62.2% | 61.4% | (many diffs) |
23 | mouse | 67946 | Spata6 | spermatogenesis associated 6 | XM_006503349.3 | 45% | 43.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1482
- ORF length:
- 1416
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gaaggtgaag gcgctgcagt gcgccctggc gctggagatc agctcagtaa 121 cttgcccagg agtcgtgcct aaagacatag aggacatcta tcttagcatc tgtgtgtttg 181 gccaatacaa aaagacacaa tgtgtcccag ccacttttcc cctggtcttc aatgccagaa 241 tggtgtttga aaaggtgttc ccggacgcag tagatcctgg agatgtggtt acacagcttg 301 aatatgatac agcagtgttc gagttgatac agctagttcc accagtgggt gaaacactgt 361 ctacgtatga cgaaaataca cgagatttca tgtttccggg tccaaaccaa atgtctggac 421 accatgattc aaaccgccag gttaccatga ggaggatttc tggccttcga ggaaatgctc 481 caaggctgga attttctacg acttcagtga ttactgaatg tctgataagt tcaaggaaat 541 gccacactca ggataaattt atttaccatt tggctccagt tgaaaaatca catggcagac 601 tgcaaaacag aacatcaaga tcacaaaaga aaaaatccaa gtcacctgag agaagtaaat 661 actgtataaa tgcaaaaaac tacgaacagc ctacaatttc ttcaaaatca cactctccat 721 ctccctacac aaaaagacgc atgtgtgagc tatctgaaga caccaggcgg cggctggccc 781 atttaaatct gggaccctat gagttcaaaa aagaaacaga taaacctcca tttgtgatta 841 gacatgttga tcccccaagt cccagggctg atactttatt gggatcttct ggaagagact 901 gtgaaagaga tggatggtca agggtgcaca atgatcattc tcatcttggc tgctgccgac 961 ccaaggatta taaggttatc aggacacccc atgggagaga cttcgatgac tctttagaaa 1021 aatgtgaaga gtatttgagc ccaaggtcgt gtagtaagcc ccggcattca gcgaggacct 1081 tgctagtcca ttcagcaccc tcaacaatgc caaagcattc tccaagccct gtgttaaata 1141 gagcttctcT CAGGGAAAGA TTTCATTCTG ATTGGTGTTC ACCTTCAAAC TGCGATGAGA 1201 TCCATGACCG GGATGAGAGA GACCTAGAGA AAGATGATGA ACTGGAACTG AAAAGAAGTC 1261 TTTTATGTAG AGACTCTGCC TATGACAGTG ACCCCGAGTA TAGCTCATGT CAGCAGCCAC 1321 GTGGCACTTT CCATTTGGAT GACGGTGAAT ACTGGTCCAA CAGGGCAGCC TCTTATAAGG 1381 GAAAATCCCA CCGACCCATC TTTGAGAACA GCATGGACAA GATGTACAGG AACTTATACA 1441 AAAAGGCCTG TAGTTCTGCT TCACATACAC AGGAAAGCTT CTGCCCAACT TTCTTGTACA 1501 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1561 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1621 AGGACGAATG TTGCTTGATG AAGCCAGGCT CACGCGTTAA GTCgacaatc aacctctgga 1681 ttacaaaatt tgtgaaagat t