Transcript: Human XM_006711411.3

PREDICTED: Homo sapiens Ral GEF with PH domain and SH3 binding motif 2 (RALGPS2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALGPS2 (55103)
Length:
1589
CDS:
87..1238

Additional Resources:

NCBI RefSeq record:
XM_006711411.3
NBCI Gene record:
RALGPS2 (55103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416506 GCCATAGTTTGGGTTATAATT pLKO_005 508 CDS 100% 15.000 21.000 N RALGPS2 n/a
2 TRCN0000420811 GGAATAGATCGTAGCTAATTT pLKO_005 1566 3UTR 100% 15.000 21.000 N RALGPS2 n/a
3 TRCN0000423067 TGACAAGAGTGGCACGAAATG pLKO_005 763 CDS 100% 10.800 7.560 N RALGPS2 n/a
4 TRCN0000047286 AGCAGTCTTGTGAATATGATA pLKO.1 214 CDS 100% 5.625 3.938 N RALGPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03523 pDONR223 100% 65.2% 65.3% None 0_1ins605;2_6delTGGGC n/a
2 ccsbBroad304_03523 pLX_304 0% 65.2% 65.3% V5 0_1ins605;2_6delTGGGC n/a
Download CSV