Transcript: Human XM_006711929.3

PREDICTED: Homo sapiens kelch like family member 29 (KLHL29), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL29 (114818)
Length:
6173
CDS:
1604..4231

Additional Resources:

NCBI RefSeq record:
XM_006711929.3
NBCI Gene record:
KLHL29 (114818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365735 ACGCAGAGCGAAAGCGTTTAC pLKO_005 2569 CDS 100% 10.800 15.120 N KLHL29 n/a
2 TRCN0000376671 ACACGGCTGCGTCGTGATAAA pLKO_005 4189 CDS 100% 13.200 10.560 N KLHL29 n/a
3 TRCN0000365801 GCAATAGAGTTTCACGTATTT pLKO_005 4501 3UTR 100% 13.200 9.240 N KLHL29 n/a
4 TRCN0000365737 TCGTCTACGATGGGAAGATTT pLKO_005 3639 CDS 100% 13.200 9.240 N KLHL29 n/a
5 TRCN0000371023 AGAGCAAGCTTGATCCCTAAA pLKO_005 4559 3UTR 100% 10.800 7.560 N KLHL29 n/a
6 TRCN0000376672 GCGGCAAGATCTACGTGTTTG pLKO_005 3789 CDS 100% 10.800 7.560 N KLHL29 n/a
7 TRCN0000371069 TTTCAAGGACCTGATTCAAAG pLKO_005 2662 CDS 100% 10.800 7.560 N KLHL29 n/a
8 TRCN0000376264 TTTCAAGGACCTGATTCAAAG pLKO_005 2662 CDS 100% 10.800 7.560 N Klhl29 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 27 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 27 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13040 pDONR223 100% 57.4% 57.4% None 1_597del;2097C>T;2107_2625del n/a
2 ccsbBroad304_13040 pLX_304 0% 57.4% 57.4% V5 1_597del;2097C>T;2107_2625del n/a
3 TRCN0000467139 CTGAATGACTCAAGCGAATCGATC pLX_317 30.2% 57.4% 57.4% V5 1_597del;2097C>T;2107_2625del n/a
Download CSV