Transcript: Human XM_006712288.3

PREDICTED: Homo sapiens transmembrane protein 182 (TMEM182), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM182 (130827)
Length:
596
CDS:
225..566

Additional Resources:

NCBI RefSeq record:
XM_006712288.3
NBCI Gene record:
TMEM182 (130827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377272 CTTCTGGAGGTGTTGGTTTAA pLKO_005 389 CDS 100% 13.200 9.240 N TMEM182 n/a
2 TRCN0000005751 GTGGAAGAGAATGACTCCAAT pLKO.1 417 CDS 100% 4.950 3.465 N TMEM182 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09530 pDONR223 100% 48.9% 48% None 331_332insTTTACCGTG;334delC;339_339delTins341 n/a
2 ccsbBroad304_09530 pLX_304 0% 48.9% 48% V5 331_332insTTTACCGTG;334delC;339_339delTins341 n/a
3 TRCN0000478198 CGCCTCCACCATATAGCTGTATCT pLX_317 39.5% 48.9% 48% V5 331_332insTTTACCGTG;334delC;339_339delTins341 n/a
Download CSV