Construct: ORF TRCN0000478198
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005747.2_s317c1
- Derived from:
- ccsbBroadEn_09530
- DNA Barcode:
- CGCCTCCACCATATAGCTGTATCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM182 (130827)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478198
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 130827 | TMEM182 | transmembrane protein 182 | NM_144632.5 | 99.8% | 99.5% | 667T>C |
| 2 | human | 130827 | TMEM182 | transmembrane protein 182 | NM_001321343.2 | 80.8% | 80.3% | 0_1ins130;3delG;538T>C |
| 3 | human | 130827 | TMEM182 | transmembrane protein 182 | NM_001321344.2 | 80.8% | 80.3% | 0_1ins130;3delG;538T>C |
| 4 | human | 130827 | TMEM182 | transmembrane protein 182 | XM_017003375.1 | 79.7% | 79% | 331_332ins138;529T>C |
| 5 | human | 130827 | TMEM182 | transmembrane protein 182 | XM_006712287.1 | 76% | 70.9% | (many diffs) |
| 6 | human | 130827 | TMEM182 | transmembrane protein 182 | XM_011510632.2 | 73.9% | 68.2% | (many diffs) |
| 7 | human | 130827 | TMEM182 | transmembrane protein 182 | NM_001321345.2 | 57.9% | 57.6% | 0_1ins288;379T>C |
| 8 | human | 130827 | TMEM182 | transmembrane protein 182 | XR_427070.2 | 50.4% | (many diffs) | |
| 9 | human | 130827 | TMEM182 | transmembrane protein 182 | XM_006712288.3 | 48.9% | 48% | 331_332insTTTACCGTG;334delC;339_339delTins341 |
| 10 | human | 130827 | TMEM182 | transmembrane protein 182 | NM_001321346.2 | 37.8% | 37.1% | 0_1ins288;43_44ins138;241T>C |
| 11 | human | 130827 | TMEM182 | transmembrane protein 182 | XM_017003376.1 | 36.6% | 29.9% | (many diffs) |
| 12 | mouse | 381339 | Tmem182 | transmembrane protein 182 | NM_001081198.1 | 85.4% | 89.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 756
- ORF length:
- 687
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagactaaat atcgctatct tctttggagc tctctttggt gctttggggg 121 tgttactctt tttggtggct tttggatcgg attattggct tcttgcaact gaagtgggga 181 gatgttcagg tgaaaagaat atagagaacg tcacttttca ccatgaaggg ttcttctgga 241 ggtgttggtt taatgggatt gtggaagaga atgactccaa tatttggaag ttctggtaca 301 ccaatcagcc accgtccaag aactgcacac atgcttacct gtctccgtac cccttcatga 361 gaggcgagca caactcgacc tcctatgact ctgcagttat ttaccgtggt ttctgggcag 421 tcctgatgct cctgggggta gttgctgtag tcatcgcaag ctttttgatc atctgtgcag 481 cccccTTCGC CAGCCATTTT CTCTACAAAG CTGGGGGAGG CTCATATATT GCTGCAGGCA 541 TCCTATTTTC ATTGGTGGTG ATGCTGTATG TCATCTGGGT CCAGGCAGTG GCTGACATGG 601 AAAGCTACCG AAACATGAAA ATGAAGGACT GCCTGGATTT CACCCCTTCT GTTCTGTATG 661 GCTGGTCATT TTTCCTGGCC CCAGCTGGGA TATTTTTTTC TTTGCTAGCT GGATTACTAT 721 TTCTGGTTGT TGGACGGCAT ATTCAGATAC ATCACTTGCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 ACGCCTCCAC CATATAGCTG TATCTACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt