Transcript: Human XM_006712300.3

PREDICTED: Homo sapiens transmembrane protein 37 (TMEM37), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM37 (140738)
Length:
1798
CDS:
420..731

Additional Resources:

NCBI RefSeq record:
XM_006712300.3
NBCI Gene record:
TMEM37 (140738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243928 CTCATCGGCTTCACCCTAATG pLKO_005 621 CDS 100% 10.800 15.120 N TMEM37 n/a
2 TRCN0000243929 ATCCTCCTCCTGGTGTCTTTC pLKO_005 543 CDS 100% 10.800 7.560 N TMEM37 n/a
3 TRCN0000243926 CCTATCAGAACCCTACCTTAA pLKO_005 1431 3UTR 100% 10.800 7.560 N TMEM37 n/a
4 TRCN0000243925 CCTGGGAATGACCGTGGAAAT pLKO_005 721 CDS 100% 10.800 7.560 N TMEM37 n/a
5 TRCN0000243927 TCCTGTCCTCGGTCTCCATTT pLKO_005 274 5UTR 100% 10.800 7.560 N TMEM37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13204 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13204 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479526 AACCACAACCCTTTTGAAAAGCCT pLX_317 100% 100% 100% V5 n/a
Download CSV