Transcript: Human XM_006712301.2

PREDICTED: Homo sapiens prominin 2 (PROM2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROM2 (150696)
Length:
4010
CDS:
437..1903

Additional Resources:

NCBI RefSeq record:
XM_006712301.2
NBCI Gene record:
PROM2 (150696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420256 ACAGACCTCAGATCCATTAAA pLKO_005 2970 3UTR 100% 15.000 10.500 N PROM2 n/a
2 TRCN0000165855 GCACCTGGATATCAACCAGTA pLKO.1 1108 CDS 100% 4.050 2.835 N PROM2 n/a
3 TRCN0000166447 CCTCCAAATACTTCCGTCCTA pLKO.1 1803 CDS 100% 2.640 1.848 N PROM2 n/a
4 TRCN0000165090 GCCTGAAAGTAGACACACAGA pLKO.1 1158 CDS 100% 2.640 1.848 N PROM2 n/a
5 TRCN0000160170 CCTCTATTCAAAGGCAGAAAT pLKO.1 3463 3UTR 100% 13.200 7.920 N PROM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15266 pDONR223 90% 58.3% 16.2% None (many diffs) n/a
2 ccsbBroad304_15266 pLX_304 0% 58.3% 16.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV