Transcript: Human XM_006712793.3

PREDICTED: Homo sapiens caspase 8 (CASP8), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASP8 (841)
Length:
1100
CDS:
277..984

Additional Resources:

NCBI RefSeq record:
XM_006712793.3
NBCI Gene record:
CASP8 (841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003579 GCCTTGATGTTATTCCAGAGA pLKO.1 397 CDS 100% 2.640 2.112 N CASP8 n/a
2 TRCN0000003578 TCACAGCATTAGGGACAGGAA pLKO.1 973 CDS 100% 2.640 2.112 N CASP8 n/a
3 TRCN0000376482 ACATGAACCTGCTGGATATTT pLKO_005 683 CDS 100% 15.000 10.500 N CASP8 n/a
4 TRCN0000377309 CACCAGGCAGGGCTCAAATTT pLKO_005 551 CDS 100% 15.000 10.500 N CASP8 n/a
5 TRCN0000376481 GGAGCTGCTCTTCCGAATTAA pLKO_005 465 CDS 100% 15.000 10.500 N CASP8 n/a
6 TRCN0000003576 GACATGAACCTGCTGGATATT pLKO.1 682 CDS 100% 13.200 9.240 N CASP8 n/a
7 TRCN0000369107 TTGCTGATTACCTACCTAAAC pLKO_005 496 CDS 100% 10.800 6.480 N CASP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10710 pDONR223 100% 81.2% 69.1% None (many diffs) n/a
2 ccsbBroad304_10710 pLX_304 79.5% 81.2% 69.1% V5 (many diffs) n/a
3 TRCN0000479793 ATACAAGAACATCTTCTGCATTCA pLX_317 37.4% 81.2% 69.1% V5 (many diffs) n/a
Download CSV