Transcript: Human XM_006713538.3

PREDICTED: Homo sapiens fibroblast growth factor 12 (FGF12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGF12 (2257)
Length:
5238
CDS:
88..624

Additional Resources:

NCBI RefSeq record:
XM_006713538.3
NBCI Gene record:
FGF12 (2257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425873 AGAACCATCGCTACATGAAAT pLKO_005 519 CDS 100% 13.200 18.480 N FGF12 n/a
2 TRCN0000421832 CTGATGTTATATACTCAATAG pLKO_005 1009 3UTR 100% 10.800 15.120 N FGF12 n/a
3 TRCN0000058474 GACTCAATAAAGAAGGTCAAA pLKO.1 419 CDS 100% 4.950 6.930 N FGF12 n/a
4 TRCN0000058477 CTACACTCTCTTCAATCTAAT pLKO.1 198 CDS 100% 13.200 9.240 N FGF12 n/a
5 TRCN0000058476 GCTTGGTTTCTGGGACTCAAT pLKO.1 406 CDS 100% 4.950 3.465 N FGF12 n/a
6 TRCN0000058475 CCAACCATGAATGGAGGCAAA pLKO.1 580 CDS 100% 4.050 2.835 N FGF12 n/a
7 TRCN0000058473 GCCATGAATGGTGAAGGCTAT pLKO.1 274 CDS 100% 4.050 2.835 N FGF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06210 pDONR223 100% 97.7% 96.6% None 4_4delAinsGAGAGCAAAG;15C>A;437C>A n/a
2 ccsbBroad304_06210 pLX_304 0% 97.7% 96.6% V5 4_4delAinsGAGAGCAAAG;15C>A;437C>A n/a
3 TRCN0000473712 GAGGGATGGAATACATTTCCAACG pLX_317 100% 97.7% 96.6% V5 4_4delAinsGAGAGCAAAG;15C>A;437C>A n/a
Download CSV