Transcript: Human XM_006713714.3

PREDICTED: Homo sapiens Rho GTPase activating protein 31 (ARHGAP31), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP31 (57514)
Length:
6349
CDS:
617..4891

Additional Resources:

NCBI RefSeq record:
XM_006713714.3
NBCI Gene record:
ARHGAP31 (57514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047640 GCTCTCCAGTAAATCAAAGAA pLKO.1 1504 CDS 100% 5.625 3.938 N ARHGAP31 n/a
2 TRCN0000047642 CCACAAGCAACAGTGGAAGTA pLKO.1 2849 CDS 100% 4.950 3.465 N ARHGAP31 n/a
3 TRCN0000047638 CCTCAAACATACAACGGCTAA pLKO.1 798 CDS 100% 4.050 2.835 N ARHGAP31 n/a
4 TRCN0000047639 CCTCATTTAGTTCACCTGGAA pLKO.1 3930 CDS 100% 2.640 1.848 N ARHGAP31 n/a
5 TRCN0000047641 CGGAGATCAGTAATTCTGGAT pLKO.1 4844 CDS 100% 2.640 1.584 N ARHGAP31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.