Transcript: Human XM_006713789.3

PREDICTED: Homo sapiens calcium sensing receptor (CASR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASR (846)
Length:
5502
CDS:
954..4190

Additional Resources:

NCBI RefSeq record:
XM_006713789.3
NBCI Gene record:
CASR (846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356801 GCTGGTTACAGGCTATGATAT pLKO_005 1159 CDS 100% 13.200 18.480 N CASR n/a
2 TRCN0000356739 TCGGGTATTACAACGTCTATG pLKO_005 2476 CDS 100% 10.800 15.120 N CASR n/a
3 TRCN0000356800 AGGATGGCTCCATCGTGTTTA pLKO_005 2449 CDS 100% 13.200 9.240 N CASR n/a
4 TRCN0000008172 CGCTGGTTACAGGCTATGATA pLKO.1 1158 CDS 100% 5.625 3.938 N CASR n/a
5 TRCN0000008175 GCTGGGTGTGTTTATCAAGTT pLKO.1 2843 CDS 100% 4.950 3.465 N CASR n/a
6 TRCN0000008171 CCAAGAAAGATCCACCCTCAA pLKO.1 5179 3UTR 100% 4.050 2.835 N CASR n/a
7 TRCN0000008174 CCTTACATAGATTACACGCAT pLKO.1 2172 CDS 100% 2.640 1.848 N CASR n/a
8 TRCN0000008173 CCAGATGACTTCTGGTCCAAT pLKO.1 2709 CDS 100% 0.495 0.347 N CASR n/a
9 TRCN0000356737 GTGGAATGTATCAGGTATAAT pLKO_005 1125 CDS 100% 15.000 9.000 N CASR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487915 TAAGTGGTTAGCTTAGGCCAATGG pLX_317 9.2% 99.9% 99.8% V5 (not translated due to prior stop codon) 2244G>C;2968A>G;3031G>C n/a
Download CSV