Transcript: Human XM_006713831.4

PREDICTED: Homo sapiens rubicon autophagy regulator (RUBCN), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUBCN (9711)
Length:
8084
CDS:
742..3279

Additional Resources:

NCBI RefSeq record:
XM_006713831.4
NBCI Gene record:
RUBCN (9711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235637 GTAAAGCGTGTTACCATAAAG pLKO_005 3104 CDS 100% 13.200 18.480 N RUBCN n/a
2 TRCN0000283271 TGTAAAGCGTGTTACCATAAA pLKO_005 3103 CDS 100% 13.200 18.480 N Rubcn n/a
3 TRCN0000235640 ATTACTGGCAGTTCGTGAAAG pLKO_005 479 5UTR 100% 10.800 15.120 N RUBCN n/a
4 TRCN0000021542 CGGTGTTCACTACCCTAATAA pLKO.1 416 5UTR 100% 15.000 12.000 N RUBCN n/a
5 TRCN0000021540 CGAGCTAATGAAGTGCAACAT pLKO.1 1803 CDS 100% 4.950 3.960 N RUBCN n/a
6 TRCN0000235638 CCTGCATGTCAGGTATCATTT pLKO_005 3623 3UTR 100% 13.200 9.240 N RUBCN n/a
7 TRCN0000021539 CCTTCCAAATACCCAGTTATT pLKO.1 5839 3UTR 100% 13.200 9.240 N RUBCN n/a
8 TRCN0000021543 CGAGAGCAGCAGTTCCAATTT pLKO.1 1278 CDS 100% 13.200 9.240 N RUBCN n/a
9 TRCN0000021541 CGGACCTGTGAAGAGTGTAAA pLKO.1 3088 CDS 100% 13.200 9.240 N RUBCN n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5326 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5326 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5324 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5324 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5324 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5491 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.