Transcript: Human XM_006714120.1

PREDICTED: Homo sapiens RNA binding motif protein 46 (RBM46), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM46 (166863)
Length:
3621
CDS:
174..1586

Additional Resources:

NCBI RefSeq record:
XM_006714120.1
NBCI Gene record:
RBM46 (166863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133862 GCAAGTATTGAGGTAACACTA pLKO.1 1068 CDS 100% 4.950 6.930 N RBM46 n/a
2 TRCN0000135051 CTCTTGATAAAGGTACAGCAA pLKO.1 3086 3UTR 100% 2.640 2.112 N RBM46 n/a
3 TRCN0000134874 CCAGAAGCATCTAACCATTAT pLKO.1 3309 3UTR 100% 13.200 9.240 N RBM46 n/a
4 TRCN0000136107 CTACTTTCTGAGTGGGCAATA pLKO.1 3141 3UTR 100% 10.800 7.560 N RBM46 n/a
5 TRCN0000133734 CAGAATGAAGCAGCATTACTT pLKO.1 231 CDS 100% 5.625 3.938 N RBM46 n/a
6 TRCN0000133882 CAGCATCTTAATGGTCAGATT pLKO.1 1122 CDS 100% 4.950 3.465 N RBM46 n/a
7 TRCN0000134111 CCTTATTCTTATCCAGGCTAT pLKO.1 2771 3UTR 100% 4.050 2.835 N RBM46 n/a
8 TRCN0000134549 GAAGATGAGTTAGTTCCTGTA pLKO.1 393 CDS 100% 4.050 2.835 N RBM46 n/a
9 TRCN0000134721 GCATTACTTGCTTTGATGGAA pLKO.1 243 CDS 100% 3.000 2.100 N RBM46 n/a
10 TRCN0000138643 CGCCTGAAGTTGAAAGATGCA pLKO.1 1258 CDS 100% 2.640 1.584 N RBM46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05139 pDONR223 100% 88% 87.6% None (many diffs) n/a
2 ccsbBroad304_05139 pLX_304 0% 88% 87.6% V5 (many diffs) n/a
3 TRCN0000470520 GGTCCCGAACCTGGGCCTTGGTGT pLX_317 25.6% 88% 87.6% V5 (many diffs) n/a
Download CSV