Transcript: Human XM_006714452.4

PREDICTED: Homo sapiens RAN binding protein 3 like (RANBP3L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RANBP3L (202151)
Length:
2627
CDS:
301..1860

Additional Resources:

NCBI RefSeq record:
XM_006714452.4
NBCI Gene record:
RANBP3L (202151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714452.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149812 GTCAGAAACAGCCCAACAATT pLKO.1 1647 CDS 100% 13.200 9.240 N RANBP3L n/a
2 TRCN0000128245 GCAATACATCATCGTCTTGTT pLKO.1 1576 CDS 100% 4.950 3.465 N RANBP3L n/a
3 TRCN0000149826 CATCATCGTCTTGTTGCACTT pLKO.1 1582 CDS 100% 4.050 2.835 N RANBP3L n/a
4 TRCN0000146897 CCATTCAAATCCATTCCGAAA pLKO.1 1102 CDS 100% 4.050 2.835 N RANBP3L n/a
5 TRCN0000149762 GCAACATCAGTAGGATGTCAA pLKO.1 946 CDS 100% 0.495 0.347 N RANBP3L n/a
6 TRCN0000128143 CAGAACCAGAATGTAATGGTT pLKO.1 482 CDS 100% 0.300 0.180 N RANBP3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714452.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09822 pDONR223 100% 88.4% 86.9% None (many diffs) n/a
2 ccsbBroad304_09822 pLX_304 0% 88.4% 86.9% V5 (many diffs) n/a
3 TRCN0000481008 ACGAGCTTTTTCACGCGCCGGTTT pLX_317 25.8% 88.4% 86.9% V5 (many diffs) n/a
Download CSV