Transcript: Human XM_006714469.2

PREDICTED: Homo sapiens retinoic acid induced 14 (RAI14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAI14 (26064)
Length:
4953
CDS:
164..3106

Additional Resources:

NCBI RefSeq record:
XM_006714469.2
NBCI Gene record:
RAI14 (26064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285442 AGTGTGTTGGCATCGAAATTA pLKO_005 2564 CDS 100% 15.000 10.500 N RAI14 n/a
2 TRCN0000275770 CTGATAGCTTATTGGATATAA pLKO_005 1161 CDS 100% 15.000 10.500 N RAI14 n/a
3 TRCN0000275822 TCGGGAAAGGAATCGGTATTT pLKO_005 1061 CDS 100% 13.200 9.240 N RAI14 n/a
4 TRCN0000275825 CCGCTGCCATTGTTCTCATTC pLKO_005 3175 3UTR 100% 10.800 7.560 N RAI14 n/a
5 TRCN0000143259 GAAGAGTACGAGGAAATGAAA pLKO.1 1883 CDS 100% 5.625 3.938 N RAI14 n/a
6 TRCN0000285443 GAAGAGTACGAGGAAATGAAA pLKO_005 1883 CDS 100% 5.625 3.938 N RAI14 n/a
7 TRCN0000142240 GCAGACCTAAACCTTGTAGAT pLKO.1 788 CDS 100% 4.950 3.465 N RAI14 n/a
8 TRCN0000140134 GCAGTGAATGCTCCTTCCATT pLKO.1 3458 3UTR 100% 4.950 3.465 N RAI14 n/a
9 TRCN0000139188 CGTAGCTTCTTCCCTTTCCAA pLKO.1 3217 3UTR 100% 3.000 2.100 N RAI14 n/a
10 TRCN0000139712 CAGCTCAAACAACTGGTGGAT pLKO.1 2306 CDS 100% 2.640 1.848 N RAI14 n/a
11 TRCN0000141278 CCTCAAAGATTTGGATGGGAA pLKO.1 601 CDS 100% 2.640 1.848 N RAI14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07983 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_07983 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
Download CSV