Transcript: Human XM_006715134.3

PREDICTED: Homo sapiens mitochondrial ribosomal protein S18A (MRPS18A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPS18A (55168)
Length:
1285
CDS:
15..827

Additional Resources:

NCBI RefSeq record:
XM_006715134.3
NBCI Gene record:
MRPS18A (55168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155784 CCCAACGCAGTGTCATAAACT pLKO.1 1100 3UTR 100% 5.625 7.875 N MRPS18A n/a
2 TRCN0000155896 CGCAGTGTCATAAACTGGGTT pLKO.1 1105 3UTR 100% 2.640 2.112 N MRPS18A n/a
3 TRCN0000231863 GAAGGGAAGACAACTATAATT pLKO_005 141 CDS 100% 15.000 10.500 N MRPS18A n/a
4 TRCN0000152297 CAAGAAGGGAAGACAACTATA pLKO.1 138 CDS 100% 13.200 9.240 N MRPS18A n/a
5 TRCN0000231864 TGAAGCACAAGTATAACTATG pLKO_005 244 CDS 100% 10.800 7.560 N MRPS18A n/a
6 TRCN0000231867 TTGGCCTGCACAGTAGCAATG pLKO_005 990 3UTR 100% 6.000 4.200 N MRPS18A n/a
7 TRCN0000231866 TCCGTCAAGCCCATCTACAAA pLKO_005 708 CDS 100% 5.625 3.938 N MRPS18A n/a
8 TRCN0000151248 GCACAAGTATAACTATGACGA pLKO.1 248 CDS 100% 2.640 1.848 N MRPS18A n/a
9 TRCN0000150846 GAACCTGAAGCACAAGTATAA pLKO.1 239 CDS 100% 13.200 7.920 N MRPS18A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03541 pDONR223 100% 72.5% 72.5% None 374_595del n/a
2 ccsbBroad304_03541 pLX_304 0% 72.5% 72.5% V5 374_595del n/a
3 TRCN0000465211 CTCCTTCAACCCACCTAAAAGTCG pLX_317 50.9% 72.5% 72.5% V5 374_595del n/a
Download CSV