Transcript: Human XM_006715150.3

PREDICTED: Homo sapiens apolipoprotein M (APOM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOM (55937)
Length:
745
CDS:
154..624

Additional Resources:

NCBI RefSeq record:
XM_006715150.3
NBCI Gene record:
APOM (55937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062508 GCTCTACTTCTATGGTATTAT pLKO.1 77 5UTR 100% 15.000 10.500 N APOM n/a
2 TRCN0000062512 CTTGGGCCAGTGGTACTTTAT pLKO.1 179 CDS 100% 13.200 9.240 N APOM n/a
3 TRCN0000371338 GGACTCCAAAGCCTTCTTATT pLKO_005 561 CDS 100% 13.200 9.240 N APOM n/a
4 TRCN0000062510 TGGACAACATTGTCTTCAATA pLKO.1 247 CDS 100% 13.200 9.240 N APOM n/a
5 TRCN0000371396 AGCGCTTTCTCCTCTACAATC pLKO_005 482 CDS 100% 10.800 7.560 N APOM n/a
6 TRCN0000062509 CCAGGTGGAATCATGCTGAAT pLKO.1 442 CDS 100% 4.950 3.465 N APOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03683 pDONR223 100% 80.7% 53.2% None 0_1ins103;167_173delGTGAGTG n/a
2 ccsbBroad304_03683 pLX_304 0% 80.7% 53.2% V5 0_1ins103;167_173delGTGAGTG n/a
3 TRCN0000474828 TCTCCCCATCTAGGCCCAATCAAC pLX_317 55.6% 80.7% 53.2% V5 0_1ins103;167_173delGTGAGTG n/a
Download CSV