Transcript: Human XM_006715339.3

PREDICTED: Homo sapiens syntaxin binding protein 5 (STXBP5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP5 (134957)
Length:
9475
CDS:
350..3757

Additional Resources:

NCBI RefSeq record:
XM_006715339.3
NBCI Gene record:
STXBP5 (134957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715339.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422190 GGGCACTGAACGAGGTAATAT pLKO_005 826 CDS 100% 15.000 21.000 N STXBP5 n/a
2 TRCN0000419981 GCACTCGAAATGGAGTATATG pLKO_005 3935 3UTR 100% 13.200 18.480 N STXBP5 n/a
3 TRCN0000430495 TTAGGAAAGTTAACGTTAAAG pLKO_005 3824 3UTR 100% 13.200 18.480 N STXBP5 n/a
4 TRCN0000429624 GATGCTTGAAGTTCGATTATT pLKO_005 1972 CDS 100% 15.000 12.000 N STXBP5 n/a
5 TRCN0000434611 GTCATTGGACTGGATTATAAA pLKO_005 4190 3UTR 100% 15.000 12.000 N STXBP5 n/a
6 TRCN0000415572 GGAGCCTTGCACAGCATATTC pLKO_005 3525 CDS 100% 13.200 10.560 N STXBP5 n/a
7 TRCN0000148758 CCTCCTCTTCTCAGGAAATTA pLKO.1 3009 CDS 100% 15.000 10.500 N STXBP5 n/a
8 TRCN0000146927 CCTGGATCATTCCTGTATTAA pLKO.1 4059 3UTR 100% 15.000 10.500 N STXBP5 n/a
9 TRCN0000431626 TGCAATAACTCTACAAGTATT pLKO_005 1747 CDS 100% 13.200 9.240 N STXBP5 n/a
10 TRCN0000146824 CCAGGTTATCAAACAGAACTA pLKO.1 2180 CDS 100% 4.950 3.465 N STXBP5 n/a
11 TRCN0000149723 GCCAAGTTTAAGACCTCTGTT pLKO.1 3220 CDS 100% 4.950 3.465 N STXBP5 n/a
12 TRCN0000149119 GCACAATCTCTTGACAGAGAA pLKO.1 3467 CDS 100% 0.495 0.347 N STXBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715339.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09557 pDONR223 100% 98.2% 98.2% None 2146_2205del;3345A>G n/a
2 ccsbBroad304_09557 pLX_304 0% 98.2% 98.2% V5 2146_2205del;3345A>G n/a
3 ccsbBroadEn_16093 pDONR223 0% 98.1% 98.1% None 1307A>G;2146_2205del;2397A>G n/a
4 ccsbBroad304_16093 pLX_304 0% 98.1% 98.1% V5 1307A>G;2146_2205del;2397A>G n/a
Download CSV