Transcript: Human XM_006715586.3

PREDICTED: Homo sapiens serine active site containing 1 (SERAC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERAC1 (84947)
Length:
3897
CDS:
292..2046

Additional Resources:

NCBI RefSeq record:
XM_006715586.3
NBCI Gene record:
SERAC1 (84947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715586.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415198 TTACTTCTGGGTATTGATTTG pLKO_005 2488 3UTR 100% 10.800 15.120 N SERAC1 n/a
2 TRCN0000430019 ACAATACCAGAGGAATAATTT pLKO_005 1646 CDS 100% 15.000 10.500 N SERAC1 n/a
3 TRCN0000415061 GTCCTGCTCTCCGAATTATAT pLKO_005 1409 CDS 100% 15.000 10.500 N SERAC1 n/a
4 TRCN0000420197 TAGGCATTGGAGATCTAATTC pLKO_005 1913 CDS 100% 13.200 9.240 N SERAC1 n/a
5 TRCN0000150795 GCTTGGAATTTGTCCTAGATA pLKO.1 2705 3UTR 100% 5.625 3.938 N SERAC1 n/a
6 TRCN0000151253 CCATTAAAGCAGATGTCCTTT pLKO.1 1253 CDS 100% 4.950 3.465 N SERAC1 n/a
7 TRCN0000156152 CGAAGCGAAGAGAGTGATCTT pLKO.1 628 CDS 100% 4.950 3.465 N SERAC1 n/a
8 TRCN0000155006 GCAAGGATTCTCCTGCACTTA pLKO.1 1760 CDS 100% 4.950 3.465 N SERAC1 n/a
9 TRCN0000153225 GCTGGTCAAATGGTAAGTCTA pLKO.1 3764 3UTR 100% 4.950 3.465 N SERAC1 n/a
10 TRCN0000151193 GCTGTGACATTAGATACTCAA pLKO.1 253 5UTR 100% 4.950 3.465 N SERAC1 n/a
11 TRCN0000152395 GCATGATTACCAGTATAGGAT pLKO.1 564 CDS 100% 3.000 2.100 N SERAC1 n/a
12 TRCN0000152226 CCTATGGAAAGAAAGTCCATT pLKO.1 1474 CDS 100% 0.495 0.347 N SERAC1 n/a
13 TRCN0000177140 GAAGTCAAAGAACTCAGCAAA pLKO.1 1744 CDS 100% 4.950 2.970 N Serac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715586.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09245 pDONR223 100% 89.1% 89.1% None 0_1ins210;39C>T;1417T>A n/a
Download CSV