Transcript: Human XM_006715747.4

PREDICTED: Homo sapiens anillin actin binding protein (ANLN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANLN (54443)
Length:
4727
CDS:
219..3536

Additional Resources:

NCBI RefSeq record:
XM_006715747.4
NBCI Gene record:
ANLN (54443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117259 CCTCACATCTATAACCACAAA pLKO.1 2837 CDS 100% 4.950 3.960 N ANLN n/a
2 TRCN0000117260 GCCTCTTTGAATAAAGCCCTA pLKO.1 1017 CDS 100% 2.160 1.728 N ANLN n/a
3 TRCN0000117257 GCCAATATTCACTACGTATTA pLKO.1 3648 3UTR 100% 13.200 9.240 N ANLN n/a
4 TRCN0000117261 CCATCAATAAAGCAGGTGATT pLKO.1 2166 CDS 100% 4.950 3.465 N ANLN n/a
5 TRCN0000117258 CCTCTTTGAATAAAGCCCTAT pLKO.1 1018 CDS 100% 4.050 2.835 N ANLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12039 pDONR223 100% 36.6% 36.6% None 1_2046del;2770_2823del n/a
2 ccsbBroad304_12039 pLX_304 0% 36.6% 36.6% V5 1_2046del;2770_2823del n/a
3 TRCN0000465225 GTCGCAGCGTATTGCCTGGATTGT pLX_317 20.8% 36.6% 36.6% V5 1_2046del;2770_2823del n/a
Download CSV