Transcript: Human XM_006715755.3

PREDICTED: Homo sapiens kelch like family member 7 (KLHL7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL7 (55975)
Length:
3513
CDS:
657..2390

Additional Resources:

NCBI RefSeq record:
XM_006715755.3
NBCI Gene record:
KLHL7 (55975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275529 AGCGAATGGACTGCTATAATG pLKO_005 1678 CDS 100% 13.200 18.480 N KLHL7 n/a
2 TRCN0000249379 TACAAGCTGAACCACTTATTC pLKO_005 1369 CDS 100% 13.200 10.560 N Klhl7 n/a
3 TRCN0000275530 TCATCAGTGAAGCGCAGTATC pLKO_005 2702 3UTR 100% 10.800 8.640 N KLHL7 n/a
4 TRCN0000249383 AGATGCTGAACCTGATATTAT pLKO_005 854 CDS 100% 15.000 10.500 N Klhl7 n/a
5 TRCN0000134868 CTGCTAGAATTTCCGTGAATA pLKO.1 901 CDS 100% 13.200 9.240 N KLHL7 n/a
6 TRCN0000275531 CTGCTAGAATTTCCGTGAATA pLKO_005 901 CDS 100% 13.200 9.240 N KLHL7 n/a
7 TRCN0000137015 CGCAGTATCTTAGCTCTAGAT pLKO.1 2714 3UTR 100% 4.950 3.465 N KLHL7 n/a
8 TRCN0000137895 GAACTGAAAGCTGGCACACAA pLKO.1 1846 CDS 100% 4.950 3.465 N KLHL7 n/a
9 TRCN0000137782 GCCTCTTTAGTCCTCACTGTT pLKO.1 3109 3UTR 100% 4.950 3.465 N KLHL7 n/a
10 TRCN0000136619 GCGAGTAACACATCTTCTCAA pLKO.1 1193 CDS 100% 4.950 3.465 N KLHL7 n/a
11 TRCN0000275532 GCGAGTAACACATCTTCTCAA pLKO_005 1193 CDS 100% 4.950 3.465 N KLHL7 n/a
12 TRCN0000138635 CCAACTCCAAAGTTCGTGCTT pLKO.1 2299 CDS 100% 2.640 1.848 N KLHL7 n/a
13 TRCN0000275533 CCAACTCCAAAGTTCGTGCTT pLKO_005 2299 CDS 100% 2.640 1.848 N KLHL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15920 pDONR223 0% 24.3% 24% None (many diffs) n/a
2 ccsbBroad304_15920 pLX_304 0% 24.3% 24% V5 (many diffs) n/a
3 TRCN0000477622 CTAGAGAGATTTAGCCCGCTCTCA pLX_317 92% 24.3% 24% V5 (many diffs) n/a
Download CSV