Transcript: Human XM_006715960.3

PREDICTED: Homo sapiens tetraspanin 33 (TSPAN33), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN33 (340348)
Length:
1905
CDS:
97..945

Additional Resources:

NCBI RefSeq record:
XM_006715960.3
NBCI Gene record:
TSPAN33 (340348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152822 GCGGACATACTTAGATCCTAA pLKO.1 1312 3UTR 100% 4.950 6.930 N TSPAN33 n/a
2 TRCN0000152435 CCTGCTCTTCTTCTTCAACAT pLKO.1 168 CDS 100% 4.950 3.465 N TSPAN33 n/a
3 TRCN0000156331 CACTACCGAGATGACTTGGAT pLKO.1 499 CDS 100% 3.000 2.100 N TSPAN33 n/a
4 TRCN0000153837 CCTTTGACTACTTGGAAGCTA pLKO.1 719 CDS 100% 3.000 2.100 N TSPAN33 n/a
5 TRCN0000158106 CTGGGTGATTTCCATGGTGAT pLKO.1 195 CDS 100% 4.050 2.430 N TSPAN33 n/a
6 TRCN0000152777 GCTCTTCTTCTTCAACATGCT pLKO.1 171 CDS 100% 2.640 1.584 N TSPAN33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05472 pDONR223 100% 99.6% 99.6% None 158_159insAGA n/a
2 ccsbBroad304_05472 pLX_304 0% 99.6% 99.6% V5 158_159insAGA n/a
3 TRCN0000471295 CGAGTGACGGCATGAGGGGAGATG pLX_317 50.4% 99.6% 99.6% V5 158_159insAGA n/a
Download CSV