Transcript: Human XM_006716352.3

PREDICTED: Homo sapiens solute carrier family 25 member 37 (SLC25A37), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A37 (51312)
Length:
1176
CDS:
29..829

Additional Resources:

NCBI RefSeq record:
XM_006716352.3
NBCI Gene record:
SLC25A37 (51312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716352.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245151 TCCACGATGCGGTAATGAATC pLKO_005 279 CDS 100% 10.800 15.120 N SLC25A37 n/a
2 TRCN0000245150 AGGCGTCAACGTCATGATCAT pLKO_005 127 CDS 100% 4.950 6.930 N SLC25A37 n/a
3 TRCN0000044009 CGTCTGTAAGACCCTTCTGAA pLKO.1 580 CDS 100% 4.950 3.960 N SLC25A37 n/a
4 TRCN0000245153 TACTAAAGGAAGGGATCATAG pLKO_005 824 CDS 100% 10.800 7.560 N SLC25A37 n/a
5 TRCN0000245152 TATGAGTTCTTCAAGTACTTT pLKO_005 770 CDS 100% 5.625 3.938 N SLC25A37 n/a
6 TRCN0000044010 GCCATTTCTTGGTCTGTCTAT pLKO.1 752 CDS 100% 4.950 3.465 N SLC25A37 n/a
7 TRCN0000044008 GCGGTAATGAATCCAGCAGAA pLKO.1 287 CDS 100% 4.050 2.835 N SLC25A37 n/a
8 TRCN0000044012 CTCCATACTAAAGGAAGGGAT pLKO.1 819 CDS 100% 2.640 1.848 N SLC25A37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716352.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08276 pDONR223 100% 78.5% 78.6% None 0_1ins216;132G>A n/a
2 ccsbBroad304_08276 pLX_304 0% 78.5% 78.6% V5 0_1ins216;132G>A n/a
3 TRCN0000467264 CCGTACCATTAAGGCTAAAAATGA pLX_317 36.6% 78.5% 78.6% V5 0_1ins216;132G>A n/a
Download CSV