Transcript: Human XM_006716518.3

PREDICTED: Homo sapiens dihydropyrimidinase (DPYS), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPYS (1807)
Length:
2092
CDS:
155..1663

Additional Resources:

NCBI RefSeq record:
XM_006716518.3
NBCI Gene record:
DPYS (1807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716518.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414308 AGATCGGATGTCCGTAATATG pLKO_005 1054 CDS 100% 13.200 18.480 N DPYS n/a
2 TRCN0000435308 TGTGGAGCGTGCACCCTATAA pLKO_005 1564 CDS 100% 13.200 18.480 N DPYS n/a
3 TRCN0000433366 TCAACTCCCTAGGATCCTTTA pLKO_005 1756 3UTR 100% 10.800 15.120 N DPYS n/a
4 TRCN0000046743 CAAGATGTTTATGGCCTATAA pLKO.1 469 CDS 100% 13.200 9.240 N DPYS n/a
5 TRCN0000046747 TGTGGCAGTTACCAGCACAAA pLKO.1 1117 CDS 100% 4.950 3.465 N DPYS n/a
6 TRCN0000046744 CTAATGATGATCTAACCACAA pLKO.1 942 CDS 100% 4.050 2.835 N DPYS n/a
7 TRCN0000046746 GTGACTATTTCAAGAGGCAAA pLKO.1 1418 CDS 100% 4.050 2.835 N DPYS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716518.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00460 pDONR223 100% 83.9% 83.9% None 262_263ins159;1074_1181del n/a
2 ccsbBroad304_00460 pLX_304 0% 83.9% 83.9% V5 262_263ins159;1074_1181del n/a
3 TRCN0000472173 GGCGCAGTCATACATCTACTTTAC pLX_317 31.3% 83.9% 83.9% V5 262_263ins159;1074_1181del n/a
Download CSV