Transcript: Human XM_006716670.3

PREDICTED: Homo sapiens TatD DNase domain containing 1 (TATDN1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TATDN1 (83940)
Length:
1051
CDS:
105..965

Additional Resources:

NCBI RefSeq record:
XM_006716670.3
NBCI Gene record:
TATDN1 (83940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424867 CGAAACTCACATGCTGAATTT pLKO_005 414 CDS 100% 13.200 10.560 N TATDN1 n/a
2 TRCN0000425301 TTTGATTGACTTGGATCTTTA pLKO_005 518 CDS 100% 13.200 9.240 N TATDN1 n/a
3 TRCN0000427802 GAAATCTACAAGACAGTAAAG pLKO_005 118 CDS 100% 10.800 7.560 N TATDN1 n/a
4 TRCN0000156010 CCACTGGAATTAGCCAATACA pLKO.1 903 CDS 100% 5.625 3.938 N TATDN1 n/a
5 TRCN0000154331 CAGTTGGATGTCATCCTACAA pLKO.1 181 CDS 100% 4.950 3.465 N TATDN1 n/a
6 TRCN0000157196 GCAATAGGAGAATGCGGACTT pLKO.1 288 CDS 100% 4.050 2.835 N TATDN1 n/a
7 TRCN0000157162 GACAGAAATGAACCCTGCCAT pLKO.1 837 CDS 100% 2.640 1.848 N TATDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09136 pDONR223 100% 74.9% 74.4% None (many diffs) n/a
2 ccsbBroad304_09136 pLX_304 0% 74.9% 74.4% V5 (many diffs) n/a
3 TRCN0000480484 AAATAACTTCCTAAAATAAATTGC pLX_317 49.6% 74.9% 74.4% V5 (many diffs) n/a
Download CSV