Transcript: Human XM_006716889.3

PREDICTED: Homo sapiens multiple PDZ domain crumbs cell polarity complex component (MPDZ), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPDZ (8777)
Length:
7546
CDS:
175..6288

Additional Resources:

NCBI RefSeq record:
XM_006716889.3
NBCI Gene record:
MPDZ (8777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145218 GACGAGCTATTGGAAGTAAAT pLKO.1 1963 CDS 100% 13.200 18.480 N MPDZ n/a
2 TRCN0000278568 GACGAGCTATTGGAAGTAAAT pLKO_005 1963 CDS 100% 13.200 18.480 N MPDZ n/a
3 TRCN0000144303 CCTCCTCAATGTAAGTCTATT pLKO.1 6019 CDS 100% 13.200 10.560 N MPDZ n/a
4 TRCN0000297489 CCTCCTCAATGTAAGTCTATT pLKO_005 6019 CDS 100% 13.200 10.560 N MPDZ n/a
5 TRCN0000141914 CAGAGCCAACTGTTACTACTT pLKO.1 4460 CDS 100% 4.950 3.960 N MPDZ n/a
6 TRCN0000142160 GAAGAGTAATGGCACTGGATA pLKO.1 3491 CDS 100% 4.950 3.465 N MPDZ n/a
7 TRCN0000278518 GAAGAGTAATGGCACTGGATA pLKO_005 3491 CDS 100% 4.950 3.465 N MPDZ n/a
8 TRCN0000141979 GTCACTGGAAAGTAGCTCAAA pLKO.1 5601 CDS 100% 4.950 3.465 N MPDZ n/a
9 TRCN0000278570 GTCACTGGAAAGTAGCTCAAA pLKO_005 5601 CDS 100% 4.950 3.465 N MPDZ n/a
10 TRCN0000142304 GCTTTCCTTACTGACAACCTA pLKO.1 6443 3UTR 100% 3.000 2.100 N MPDZ n/a
11 TRCN0000140223 GCCAGAATTGAACCAACCCAA pLKO.1 6296 3UTR 100% 2.640 1.848 N MPDZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.