Transcript: Human XM_006717002.4

PREDICTED: Homo sapiens FA complementation group C (FANCC), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FANCC (2176)
Length:
1786
CDS:
263..1627

Additional Resources:

NCBI RefSeq record:
XM_006717002.4
NBCI Gene record:
FANCC (2176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717002.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358554 GAGTTTGTGTCCCACTTATTA pLKO_005 816 CDS 100% 15.000 12.000 N FANCC n/a
2 TRCN0000083369 CGAGTTTGTGTCCCACTTATT pLKO.1 815 CDS 100% 13.200 10.560 N FANCC n/a
3 TRCN0000083372 GTGAGAGAAATTGTCTGAGAA pLKO.1 1053 CDS 100% 4.950 3.960 N FANCC n/a
4 TRCN0000083370 CCTGGATACAGGGTGTATTAT pLKO.1 597 CDS 100% 15.000 10.500 N FANCC n/a
5 TRCN0000083368 CCTGGAAATCATAGCCACTAT pLKO.1 1186 CDS 100% 4.950 3.465 N FANCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717002.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00537 pDONR223 100% 80.7% 80.1% None (many diffs) n/a
2 ccsbBroad304_00537 pLX_304 0% 80.7% 80.1% V5 (many diffs) n/a
3 TRCN0000481140 TTGCTTTTGGTTTAGGATGTACTA pLX_317 23.4% 80.7% 80.1% V5 (many diffs) n/a
Download CSV