Construct: ORF TRCN0000481140
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012273.1_s317c1
- Derived from:
- ccsbBroadEn_00537
- DNA Barcode:
- TTGCTTTTGGTTTAGGATGTACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FANCC (2176)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481140
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2176 | FANCC | FA complementation group C | NM_000136.3 | 100% | 100% | |
| 2 | human | 2176 | FANCC | FA complementation group C | NM_001243743.1 | 100% | 100% | |
| 3 | human | 2176 | FANCC | FA complementation group C | XM_011518365.3 | 100% | 100% | |
| 4 | human | 2176 | FANCC | FA complementation group C | XM_024447451.1 | 100% | 100% | |
| 5 | human | 2176 | FANCC | FA complementation group C | XM_006717001.3 | 90.1% | 90.1% | 521_522ins165 |
| 6 | human | 2176 | FANCC | FA complementation group C | NM_001243744.1 | 83.4% | 79% | (many diffs) |
| 7 | human | 2176 | FANCC | FA complementation group C | XM_006717002.4 | 80.7% | 80.1% | (many diffs) |
| 8 | human | 2176 | FANCC | FA complementation group C | XM_011518366.3 | 79.6% | 79.3% | 1330_1331insTC;1333delT;1335_1336ins338 |
| 9 | human | 2176 | FANCC | FA complementation group C | XM_011518367.2 | 72.7% | 72.7% | 0_1ins456 |
| 10 | human | 2176 | FANCC | FA complementation group C | XM_017014452.2 | 72.7% | 72.7% | 0_1ins456 |
| 11 | human | 2176 | FANCC | FA complementation group C | XM_017014453.1 | 72.7% | 72.7% | 0_1ins456 |
| 12 | human | 2176 | FANCC | FA complementation group C | XM_017014454.1 | 62.9% | 62.9% | 0_1ins456;65_66ins165 |
| 13 | human | 2176 | FANCC | FA complementation group C | XM_006717004.4 | 61.2% | 58.9% | 994_995ins76;1026_1027ins572 |
| 14 | human | 2176 | FANCC | FA complementation group C | XM_005251802.3 | 59.2% | 58.9% | 0_1ins670;2T>C;5_6insGCCATTTTGCT |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1740
- ORF length:
- 1674
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcaagattca gtagatcttt cttgtgatta tcagttttgg atgcagaagc 121 tttctgtatg ggatcaggct tccactttgg aaacccagca agacacctgt cttcacgtgg 181 ctcagttcca ggagttccta aggaagatgt atgaagcctt gaaagagatg gattctaata 241 cagtcattga aagattcccc acaattggtc aactgttggc aaaagcttgt tggaatcctt 301 ttattttagc atatgatgaa agccaaaaaa ttctaatatg gtgcttatgt tgtctaatta 361 acaaagaacc acagaattct ggacaatcaa aacttaactc ctggatacag ggtgtattat 421 ctcatatact ttcagcactc agatttgata aagaagttgc tcttttcact caaggtcttg 481 ggtatgcacc tatagattac tatcctggtt tgcttaaaaa tatggtttta tcattagcgt 541 ctgaactcag agagaatcat cttaatggat ttaacactca aaggcgaatg gctcccgagc 601 gagtggcgtc cctgtcacga gtttgtgtcc cacttattac cctgacagat gttgaccccc 661 tggtggaggc tctcctcatc tgtcatggac gtgaacctca ggaaatcctc cagccagagt 721 tctttgaggc tgtaaacgag gccattttgc tgaagaagat ttctctcccc atgtcagctg 781 tagtctgcct ctggcttcgg caccttccca gccttgaaaa agcaatgctg catctttttg 841 aaaagctaat ctccagtgag agaaattgtc tgagaaggat cgaatgcttt ataaaagatt 901 catcgctgcc tcaagcagcc tgccaccctg ccatattccg ggttgttgat gagatgttca 961 ggtgtgcact cctggaaacc gatggggccc tggaaatcat agccactatt caggtgttta 1021 cgcagtgctt tgtagaagct ctggagaaag caagcaagca gctgcggttt gcactcaaga 1081 cctactttcc ttacacttct ccatctcttg ccatggtgct gctgcaagac cctcaagata 1141 tccctcgggg acactggctc cagacactga agcatatttc tgaactgctc agagaagcag 1201 ttgaagacca gactcatggg tcctgcggag gtccctttga gagctggttc ctgttcattc 1261 acttcggagg atgggctgag atggtggcag agcaattact gatgtcggca gccgaacccc 1321 ccacggccct gctgtggctc ttggccttct acTACGGCCC CCGTGATGGG AGGCAGCAGA 1381 GAGCACAGAC TATGGTCCAG GTGAAGGCCG TGCTGGGCCA CCTCCTGGCA ATGTCCAGAA 1441 GCAGCAGCCT CTCAGCCCAG GACCTGCAGA CGGTAGCAGG ACAGGGCACA GACACAGACC 1501 TCAGAGCTCC TGCACAACAG CTGATCAGGC ACCTTCTCCT CAACTTCCTG CTCTGGGCTC 1561 CTGGAGGCCA CACGATCGCC TGGGATGTCA TCACCCTGAT GGCTCACACT GCTGAGATAA 1621 CTCACGAGAT CATTGGCTTT CTTGACCAGA CCTTGTACAG ATGGAATCGT CTTGGCATTG 1681 AAAGCCCTAG ATCAGAAAAA CTGGCCCGAG AGCTCCTTAA AGAGCTGCGA ACTCAAGTCT 1741 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1801 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1861 TTTATATATC TTGTGGAAAG GACGATTGCT TTTGGTTTAG GATGTACTAA CGCGTTAAGT 1921 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt