Transcript: Human XM_006717130.1

PREDICTED: Homo sapiens PBX homeobox 3 (PBX3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PBX3 (5090)
Length:
2904
CDS:
83..1450

Additional Resources:

NCBI RefSeq record:
XM_006717130.1
NBCI Gene record:
PBX3 (5090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234313 ACTCGGATACCTCTAACTAAT pLKO_005 1431 CDS 100% 13.200 18.480 N PBX3 n/a
2 TRCN0000018895 GCGAACTCATACAAACCAATA pLKO.1 2304 3UTR 100% 10.800 15.120 N PBX3 n/a
3 TRCN0000075387 GCACTCGGATACCTCTAACTA pLKO.1 1429 CDS 100% 5.625 7.875 N Pbx3 n/a
4 TRCN0000334000 GCACTCGGATACCTCTAACTA pLKO_005 1429 CDS 100% 5.625 7.875 N Pbx3 n/a
5 TRCN0000075386 ACTCTATTGAACACTCAGATT pLKO.1 516 CDS 100% 4.950 6.930 N Pbx3 n/a
6 TRCN0000018896 CCACACCAAATTCCGGTTCTT pLKO.1 1140 CDS 100% 4.950 6.930 N PBX3 n/a
7 TRCN0000234312 AGAGTAGAACACGTCCCATTT pLKO_005 645 CDS 100% 10.800 8.640 N PBX3 n/a
8 TRCN0000018899 CACACAGAACTGGAGAAATAT pLKO.1 572 CDS 100% 15.000 10.500 N PBX3 n/a
9 TRCN0000218798 ACTAAACCTCAACCGTTAAAG pLKO_005 1795 3UTR 100% 13.200 9.240 N PBX3 n/a
10 TRCN0000218305 AGCTAATGAGACTGGACAATA pLKO_005 402 CDS 100% 13.200 9.240 N PBX3 n/a
11 TRCN0000018897 GCTAATGAGACTGGACAATAT pLKO.1 403 CDS 100% 13.200 9.240 N PBX3 n/a
12 TRCN0000234311 GGTTCTTCAGATAACTCTATT pLKO_005 503 CDS 100% 13.200 9.240 N PBX3 n/a
13 TRCN0000018898 CAAACGAATCAGGTACAAGAA pLKO.1 1009 CDS 100% 4.950 3.465 N PBX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11017 pDONR223 100% 60.2% 60.2% None 1_543del n/a
2 ccsbBroad304_11017 pLX_304 0% 60.2% 60.2% V5 1_543del n/a
3 TRCN0000473112 AAAGCGGGCGCATTTGCAGTCACT pLX_317 40.2% 60.2% 60.2% V5 1_543del n/a
Download CSV