Transcript: Human XM_006717215.4

PREDICTED: Homo sapiens zinc finger protein 462 (ZNF462), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF462 (58499)
Length:
12385
CDS:
2081..9781

Additional Resources:

NCBI RefSeq record:
XM_006717215.4
NBCI Gene record:
ZNF462 (58499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414171 AGATCAACAACGCGATGATAT pLKO_005 4935 CDS 100% 13.200 18.480 N ZNF462 n/a
2 TRCN0000427100 GTGTAGTAACTGCCGACAAAT pLKO_005 9726 CDS 100% 13.200 18.480 N ZNF462 n/a
3 TRCN0000107906 GCCACGACATTGATGCGTATT pLKO.1 7236 CDS 100% 10.800 15.120 N ZNF462 n/a
4 TRCN0000095830 CCGCTGTGATAAGTGTACCTT pLKO.1 9160 CDS 100% 3.000 4.200 N Zfp462 n/a
5 TRCN0000419085 GACTCCAATGACTCATCATAT pLKO_005 8678 CDS 100% 13.200 10.560 N ZNF462 n/a
6 TRCN0000415242 TTAGGACTGAACAATCTATTT pLKO_005 9896 3UTR 100% 13.200 10.560 N ZNF462 n/a
7 TRCN0000107908 GCGCAGCATCTTAGAGTCTAT pLKO.1 2755 CDS 100% 4.950 3.960 N ZNF462 n/a
8 TRCN0000423999 GTATGCCAATCTGAGTATAAC pLKO_005 6500 CDS 100% 13.200 9.240 N ZNF462 n/a
9 TRCN0000417270 AGAAGCTCCATGACGGTAGAA pLKO_005 10111 3UTR 100% 4.950 3.465 N ZNF462 n/a
10 TRCN0000107905 CGGATCTTCATCATGGAAGTT pLKO.1 10013 3UTR 100% 4.950 3.465 N ZNF462 n/a
11 TRCN0000107907 CCCGAATGTTAGAAGCCTGAT pLKO.1 4882 CDS 100% 4.050 2.835 N ZNF462 n/a
12 TRCN0000107909 GCGCAACATGATTGACCACAT pLKO.1 9058 CDS 100% 4.050 2.835 N ZNF462 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12414 pDONR223 100% 34.4% 34.4% None (many diffs) n/a
2 ccsbBroad304_12414 pLX_304 0% 34.4% 34.4% V5 (many diffs) n/a
3 TRCN0000471691 GTTTATACCTGTTCAGACCGAGCT pLX_317 16.5% 34.4% 34.4% V5 (many diffs) n/a
Download CSV