Transcript: Human XM_006717294.1

PREDICTED: Homo sapiens AT-hook transcription factor (AKNA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKNA (80709)
Length:
5393
CDS:
147..4466

Additional Resources:

NCBI RefSeq record:
XM_006717294.1
NBCI Gene record:
AKNA (80709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017861 CCCTGCCCATTGCACGTAAAT pLKO.1 2304 CDS 100% 13.200 18.480 N AKNA n/a
2 TRCN0000428270 ATCAGCACAGCAGGAACATTA pLKO_005 2988 CDS 100% 13.200 9.240 N AKNA n/a
3 TRCN0000430474 ACGGAGAAGATGGTATCTATG pLKO_005 2646 CDS 100% 10.800 7.560 N AKNA n/a
4 TRCN0000418498 CACTCCCTTCCCGATTCATTG pLKO_005 1063 CDS 100% 10.800 7.560 N AKNA n/a
5 TRCN0000017860 CCAATACACAGGCCACGAATA pLKO.1 3797 CDS 100% 10.800 7.560 N AKNA n/a
6 TRCN0000017858 GCAGACAAAGACGTCACCTAA pLKO.1 1040 CDS 100% 4.950 3.465 N AKNA n/a
7 TRCN0000017859 GCTCAGAAACAAGCAGAGTTT pLKO.1 2929 CDS 100% 4.950 3.465 N AKNA n/a
8 TRCN0000017862 CCCACCAAAGTAGTATGACCA pLKO.1 2791 CDS 100% 2.640 1.848 N AKNA n/a
9 TRCN0000414690 TCCAGCTAATAATAGGTATTT pLKO_005 4770 3UTR 100% 13.200 7.920 N AKNA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.