Transcript: Human XM_006717435.4

PREDICTED: Homo sapiens Kin17 DNA and RNA binding protein (KIN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIN (22944)
Length:
3474
CDS:
281..1147

Additional Resources:

NCBI RefSeq record:
XM_006717435.4
NBCI Gene record:
KIN (22944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717435.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218858 GAAATCTGCACTGGATGAAAT pLKO_005 733 CDS 100% 13.200 9.240 N KIN n/a
2 TRCN0000226385 CAACATTGTCTACAACGAATA pLKO_005 235 5UTR 100% 10.800 7.560 N KIN n/a
3 TRCN0000000066 CAGCTACTATCGTCATTGAAA pLKO.1 1059 CDS 100% 5.625 3.938 N KIN n/a
4 TRCN0000000067 CTGTTGTGAAGATGATTGATT pLKO.1 903 CDS 100% 5.625 3.938 N KIN n/a
5 TRCN0000226386 TGAAGAGAAAGTCACGTTTAA pLKO_005 559 CDS 100% 13.200 7.920 N KIN n/a
6 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2785 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717435.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14073 pDONR223 100% 69.5% 7.1% None (many diffs) n/a
2 ccsbBroad304_14073 pLX_304 0% 69.5% 7.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV